CU141457 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GAAATGGAGCAGTAACGACGAGTCTGGTAGTGTAGAAAATGATAATTTATTATCATCAGAGGGAGTTGACGATAGCCTCTCTAGAGAGCATCAAAATGATGATCATAGTAGTGATAGAAATTAGTGAGCATAACTCATTTTTGTTCCCTCATTCTTACAACACCATATAGAAGGTGAAGGATTAAATTGAAAACGCGGGAAAAAGCATACAAACAAAACAAATAAAACTAACGTTATAATATTTCACAGATGAAGAGAGG
BLAST of CU141457 vs. TrEMBL
Match: A0A0A0LEI5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G769670 PE=4 SV=1) HSP 1 Score: 85.9 bits (211), Expect = 2.6e-14 Identity = 40/40 (100.00%), Postives = 40/40 (100.00%), Query Frame = 2
BLAST of CU141457 vs. NCBI nr
Match: gi|700203969|gb|KGN59102.1| (hypothetical protein Csa_3G769670 [Cucumis sativus]) HSP 1 Score: 80.5 bits (197), Expect = 1.6e-12 Identity = 40/40 (100.00%), Postives = 40/40 (100.00%), Query Frame = 2
BLAST of CU141457 vs. NCBI nr
Match: gi|449465505|ref|XP_004150468.1| (PREDICTED: DUF21 domain-containing protein At1g55930, chloroplastic isoform X1 [Cucumis sativus]) HSP 1 Score: 80.5 bits (197), Expect = 1.6e-12 Identity = 40/40 (100.00%), Postives = 40/40 (100.00%), Query Frame = 2
BLAST of CU141457 vs. NCBI nr
Match: gi|778684204|ref|XP_011651999.1| (PREDICTED: putative DUF21 domain-containing protein At3g13070, chloroplastic isoform X2 [Cucumis sativus]) HSP 1 Score: 80.5 bits (197), Expect = 1.6e-12 Identity = 40/40 (100.00%), Postives = 40/40 (100.00%), Query Frame = 2
BLAST of CU141457 vs. NCBI nr
Match: gi|659126013|ref|XP_008462967.1| (PREDICTED: DUF21 domain-containing protein At1g55930, chloroplastic isoform X1 [Cucumis melo]) HSP 1 Score: 79.0 bits (193), Expect = 4.6e-12 Identity = 39/40 (97.50%), Postives = 40/40 (100.00%), Query Frame = 2
BLAST of CU141457 vs. NCBI nr
Match: gi|659126017|ref|XP_008462970.1| (PREDICTED: putative DUF21 domain-containing protein At3g13070, chloroplastic isoform X2 [Cucumis melo]) HSP 1 Score: 79.0 bits (193), Expect = 4.6e-12 Identity = 39/40 (97.50%), Postives = 40/40 (100.00%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|