CU139370 (transcribed_cluster) Cucumber (Chinese Long) v2 | Cucurbit Genomics Database (CuGenDB)


Name	CU139370
Type	transcribed_cluster
Organism	Cucumis. sativus (Cucumber (Chinese Long) v2)
Description	No hit
Location	Chr7 : 10445927 .. 10446040 (-)
Sequence length	116

The following sequences are available for this feature:

ATTTGAGGCCGAACCGTTCTTCTTAGCTTTAAGCCACCAACATTTCTTCATTCATCGATCCATGAACTTAAGCTCCTTCAACTTCTTCTTTTTCATCTTCTCTATTCAATTTACCC


Library category	ESTs
gynoecious flower library	1

The following BLAST results are available for this feature:


Match Name	E-value	Identity	Description

This transcribed_cluster is associated with the following gene feature(s):


Feature Name	Unique Name	Type
Csa7G298770	Csa7G298770	gene
Csa7G298780	Csa7G298780	gene

The following EST feature(s) are a part of this transcribed_cluster:


Feature Name	Unique Name	Type
G0061412	G0061412	EST