CU138580 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGGGAGTTTTGACCTACCTGGAAGAGTAGGACCTGAAACCTAGCAATGTCAGTGTCCAAAGGCAATTTCATAGTCCCAAGGGATACTCCATCTTCAGGGTCATCTTCTGAGGGCACAATGTCGTTGTTCTCATCCGAAGACTTGGGCACCAGCTTGGGAATCCTGTGGCATGGACCTGAGACTTGGGAGAAATTGGAGATTTGGCGATACCGAGTGTTGGAAGCGAAGAAAACCA
BLAST of CU138580 vs. TrEMBL
Match: A0A0A0KFD4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G452740 PE=4 SV=1) HSP 1 Score: 148.7 bits (374), Expect = 3.0e-33 Identity = 72/72 (100.00%), Postives = 72/72 (100.00%), Query Frame = -3
BLAST of CU138580 vs. TrEMBL
Match: A0A0D2NT44_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_006G153100 PE=4 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 1.2e-08 Identity = 35/60 (58.33%), Postives = 42/60 (70.00%), Query Frame = -3
BLAST of CU138580 vs. TrEMBL
Match: A0A0D2QAJ7_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_006G153100 PE=4 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 1.2e-08 Identity = 35/60 (58.33%), Postives = 42/60 (70.00%), Query Frame = -3
BLAST of CU138580 vs. TrEMBL
Match: A0A0D2RWU2_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_006G153100 PE=4 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 1.2e-08 Identity = 35/60 (58.33%), Postives = 42/60 (70.00%), Query Frame = -3
BLAST of CU138580 vs. TrEMBL
Match: M5VR68_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa011731mg PE=4 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 2.6e-08 Identity = 35/56 (62.50%), Postives = 40/56 (71.43%), Query Frame = -3
BLAST of CU138580 vs. NCBI nr
Match: gi|449451154|ref|XP_004143327.1| (PREDICTED: uncharacterized protein LOC101214488 [Cucumis sativus]) HSP 1 Score: 147.9 bits (372), Expect = 7.4e-33 Identity = 72/72 (100.00%), Postives = 72/72 (100.00%), Query Frame = -3
BLAST of CU138580 vs. NCBI nr
Match: gi|659125240|ref|XP_008462584.1| (PREDICTED: uncharacterized protein LOC103500909 [Cucumis melo]) HSP 1 Score: 136.7 bits (343), Expect = 1.7e-29 Identity = 67/72 (93.06%), Postives = 68/72 (94.44%), Query Frame = -3
BLAST of CU138580 vs. NCBI nr
Match: gi|719974756|ref|XP_010245745.1| (PREDICTED: uncharacterized protein LOC104589201 [Nelumbo nucifera]) HSP 1 Score: 70.1 bits (170), Expect = 2.0e-09 Identity = 38/67 (56.72%), Postives = 48/67 (71.64%), Query Frame = -3
BLAST of CU138580 vs. NCBI nr
Match: gi|645276909|ref|XP_008243513.1| (PREDICTED: uncharacterized protein LOC103341746 [Prunus mume]) HSP 1 Score: 66.2 bits (160), Expect = 2.8e-08 Identity = 36/56 (64.29%), Postives = 40/56 (71.43%), Query Frame = -3
BLAST of CU138580 vs. NCBI nr
Match: gi|763769118|gb|KJB36333.1| (hypothetical protein B456_006G153100 [Gossypium raimondii]) HSP 1 Score: 65.9 bits (159), Expect = 3.7e-08 Identity = 35/60 (58.33%), Postives = 42/60 (70.00%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|