CU138470 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GAAGCATCTAAGTTTGCACAATCTATATTGATATCTGCTCAACTCTAGCTTGACATTGCAAAACTTGGATAGAATGTTCCAGTGGATGGTTTAGGACCGAACTCAAGAACACGAGCATTGCATAAGTACCTGATGATTCAAGAAAGCAGAATATTTCTGATTTTGGTGTATGGATATTCTCACATGTTTGAAGCGGGGTA
BLAST of CU138470 vs. TrEMBL
Match: A0A0A0KD92_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G087800 PE=4 SV=1) HSP 1 Score: 80.1 bits (196), Expect = 1.1e-12 Identity = 38/39 (97.44%), Postives = 38/39 (97.44%), Query Frame = 1
BLAST of CU138470 vs. NCBI nr
Match: gi|700191148|gb|KGN46352.1| (hypothetical protein Csa_6G087800 [Cucumis sativus]) HSP 1 Score: 81.3 bits (199), Expect = 7.2e-13 Identity = 38/39 (97.44%), Postives = 38/39 (97.44%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|