CU137649 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ATTGGGTTCATTATGCAATTCATCGCCCAGAGCCACACATAATGTTGTTCAGAAGGCCACTCAACTATCAACAGCAGCATGAGAATCAAAGCACAACAGCAGATTTTGGCCAAGTAAATTGGTTTATTGTCCTTTTTTTTCTTAGACACACTATAATGAGAAATATCTCACTACAAAACATAAAAAATTAGTGTTGTGT
BLAST of CU137649 vs. Swiss-Prot
Match: CKS1_ARATH (Cyclin-dependent kinases regulatory subunit 1 OS=Arabidopsis thaliana GN=CKS1 PE=1 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 8.6e-11 Identity = 27/30 (90.00%), Postives = 27/30 (90.00%), Query Frame = 3
BLAST of CU137649 vs. Swiss-Prot
Match: CKS2_ARATH (Cyclin-dependent kinases regulatory subunit 2 OS=Arabidopsis thaliana GN=CKS2 PE=3 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 4.3e-10 Identity = 26/29 (89.66%), Postives = 26/29 (89.66%), Query Frame = 3
BLAST of CU137649 vs. Swiss-Prot
Match: CKS1_ORYSI (Cyclin-dependent kinases regulatory subunit 1 OS=Oryza sativa subsp. indica GN=CKS1 PE=2 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 2.8e-09 Identity = 26/33 (78.79%), Postives = 26/33 (78.79%), Query Frame = 3
BLAST of CU137649 vs. Swiss-Prot
Match: CKS1_ORYSJ (Cyclin-dependent kinases regulatory subunit 1 OS=Oryza sativa subsp. japonica GN=CKS1 PE=2 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 2.8e-09 Identity = 26/33 (78.79%), Postives = 26/33 (78.79%), Query Frame = 3
BLAST of CU137649 vs. TrEMBL
Match: M0S762_MUSAM (Cyclin-dependent kinases regulatory subunit OS=Musa acuminata subsp. malaccensis PE=3 SV=1) HSP 1 Score: 68.9 bits (167), Expect = 2.5e-09 Identity = 29/33 (87.88%), Postives = 30/33 (90.91%), Query Frame = 3
BLAST of CU137649 vs. TrEMBL
Match: M0S766_MUSAM (Cyclin-dependent kinases regulatory subunit OS=Musa acuminata subsp. malaccensis PE=3 SV=1) HSP 1 Score: 68.9 bits (167), Expect = 2.5e-09 Identity = 29/33 (87.88%), Postives = 30/33 (90.91%), Query Frame = 3
BLAST of CU137649 vs. TrEMBL
Match: A0A0B0PI45_GOSAR (Cyclin-dependent kinases regulatory subunit OS=Gossypium arboreum GN=F383_29921 PE=3 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 4.3e-09 Identity = 29/33 (87.88%), Postives = 30/33 (90.91%), Query Frame = 3
BLAST of CU137649 vs. TrEMBL
Match: A0A061GWB0_THECC (Cyclin-dependent kinases regulatory subunit OS=Theobroma cacao GN=TCM_041571 PE=3 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 4.3e-09 Identity = 29/33 (87.88%), Postives = 30/33 (90.91%), Query Frame = 3
BLAST of CU137649 vs. TrEMBL
Match: A0A0D2PXL2_GOSRA (Cyclin-dependent kinases regulatory subunit OS=Gossypium raimondii GN=B456_001G117400 PE=3 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 4.3e-09 Identity = 29/33 (87.88%), Postives = 30/33 (90.91%), Query Frame = 3
BLAST of CU137649 vs. NCBI nr
Match: gi|743875912|ref|XP_010907452.1| (PREDICTED: cyclin-dependent kinases regulatory subunit 1 [Elaeis guineensis]) HSP 1 Score: 71.6 bits (174), Expect = 5.6e-10 Identity = 31/38 (81.58%), Postives = 33/38 (86.84%), Query Frame = 3
BLAST of CU137649 vs. NCBI nr
Match: gi|672140867|ref|XP_008794250.1| (PREDICTED: cyclin-dependent kinases regulatory subunit 1 [Phoenix dactylifera]) HSP 1 Score: 69.7 bits (169), Expect = 2.1e-09 Identity = 30/38 (78.95%), Postives = 32/38 (84.21%), Query Frame = 3
BLAST of CU137649 vs. NCBI nr
Match: gi|695005373|ref|XP_009389135.1| (PREDICTED: cyclin-dependent kinases regulatory subunit 1-like [Musa acuminata subsp. malaccensis]) HSP 1 Score: 68.6 bits (166), Expect = 4.7e-09 Identity = 29/33 (87.88%), Postives = 30/33 (90.91%), Query Frame = 3
BLAST of CU137649 vs. NCBI nr
Match: gi|695005362|ref|XP_009389130.1| (PREDICTED: cyclin-dependent kinases regulatory subunit 1 [Musa acuminata subsp. malaccensis]) HSP 1 Score: 68.6 bits (166), Expect = 4.7e-09 Identity = 29/33 (87.88%), Postives = 30/33 (90.91%), Query Frame = 3
BLAST of CU137649 vs. NCBI nr
Match: gi|470116787|ref|XP_004294559.1| (PREDICTED: cyclin-dependent kinases regulatory subunit 1 [Fragaria vesca subsp. vesca]) HSP 1 Score: 68.2 bits (165), Expect = 6.2e-09 Identity = 29/33 (87.88%), Postives = 30/33 (90.91%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|