CU136998 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTAGAGGCGGCGATGGATCTCCCGGAGAAGGGCCTCTGAACATCAGGAGGTAATAATTAGTAGAAATTGTTGAGAATTAAGTGGAATTGTTAGTGATTGATGTGGAAAATTTTGTTGGTTTTGTAGACCAATTGTTGTTTTCAAGCAAGGGTTTCGAAGTCGTCAATACTGTTTGGTGGAATGTTCAGATATATGCAATTTGATCGGAGATGGTGAT
BLAST of CU136998 vs. TrEMBL
Match: A0A0A0LA46_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G198460 PE=4 SV=1) HSP 1 Score: 70.1 bits (170), Expect = 1.3e-09 Identity = 31/31 (100.00%), Postives = 31/31 (100.00%), Query Frame = 2
BLAST of CU136998 vs. TrEMBL
Match: A0A0A0LA46_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G198460 PE=4 SV=1) HSP 1 Score: 38.5 bits (88), Expect = 4.0e+00 Identity = 16/16 (100.00%), Postives = 16/16 (100.00%), Query Frame = 3
HSP 2 Score: 69.3 bits (168), Expect = 2.1e-09 Identity = 30/31 (96.77%), Postives = 31/31 (100.00%), Query Frame = 2
BLAST of CU136998 vs. TrEMBL
Match: F6GYH5_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_09s0054g01760 PE=4 SV=1) HSP 1 Score: 38.5 bits (88), Expect = 4.0e+00 Identity = 16/16 (100.00%), Postives = 16/16 (100.00%), Query Frame = 3
HSP 2 Score: 69.3 bits (168), Expect = 2.1e-09 Identity = 30/31 (96.77%), Postives = 31/31 (100.00%), Query Frame = 2
BLAST of CU136998 vs. TrEMBL
Match: A0A067JYE1_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_22560 PE=4 SV=1) HSP 1 Score: 37.0 bits (84), Expect = 1.2e+01 Identity = 15/16 (93.75%), Postives = 16/16 (100.00%), Query Frame = 3
HSP 2 Score: 68.9 bits (167), Expect = 2.8e-09 Identity = 29/31 (93.55%), Postives = 31/31 (100.00%), Query Frame = 2
BLAST of CU136998 vs. TrEMBL
Match: A0A068VD49_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00004143001 PE=4 SV=1) HSP 1 Score: 34.7 bits (78), Expect = 5.8e+01 Identity = 15/16 (93.75%), Postives = 15/16 (93.75%), Query Frame = 3
HSP 2 Score: 68.2 bits (165), Expect = 4.8e-09 Identity = 29/31 (93.55%), Postives = 31/31 (100.00%), Query Frame = 2
BLAST of CU136998 vs. NCBI nr
Match: gi|449445931|ref|XP_004140725.1| (PREDICTED: uncharacterized protein LOC101203967 [Cucumis sativus]) HSP 1 Score: 72.8 bits (177), Expect = 2.8e-10 Identity = 31/31 (100.00%), Postives = 31/31 (100.00%), Query Frame = 2
BLAST of CU136998 vs. NCBI nr
Match: gi|659112369|ref|XP_008456185.1| (PREDICTED: uncharacterized protein LOC103496200 [Cucumis melo]) HSP 1 Score: 72.8 bits (177), Expect = 2.8e-10 Identity = 31/31 (100.00%), Postives = 31/31 (100.00%), Query Frame = 2
BLAST of CU136998 vs. NCBI nr
Match: gi|643711518|gb|KDP25025.1| (hypothetical protein JCGZ_22560 [Jatropha curcas]) HSP 1 Score: 72.0 bits (175), Expect = 4.7e-10 Identity = 30/31 (96.77%), Postives = 31/31 (100.00%), Query Frame = 2
BLAST of CU136998 vs. NCBI nr
Match: gi|297735671|emb|CBI18358.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 72.0 bits (175), Expect = 4.7e-10 Identity = 30/31 (96.77%), Postives = 31/31 (100.00%), Query Frame = 2
BLAST of CU136998 vs. NCBI nr
Match: gi|802742272|ref|XP_012087280.1| (PREDICTED: uncharacterized protein LOC105646115 isoform X2 [Jatropha curcas]) HSP 1 Score: 72.0 bits (175), Expect = 4.7e-10 Identity = 30/31 (96.77%), Postives = 31/31 (100.00%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|