CU135566 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGGTCCATTTACGGTCCGGGGAGTTTCATCCCCATTTTGATTAGAGAAGTAAGTCGGGTCATCGAGCGAAGATATCGGATCCTCATCCATTCTCTAAGGCGCGAATTGGCTGATTTCTTGATCGAAAGAAGTCAAATCGAGAAGCAAAGGAGCCAAGGAAAAAGAGTTGAAAGTTAGGCCGACGGCCTTATATTATAGCTCATTCGCCGAACCATGGATGAAAGCCAAAGCTTCTAATGGA
BLAST of CU135566 vs. TrEMBL
Match: A0A0A0K7B7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G388320 PE=4 SV=1) HSP 1 Score: 94.0 bits (232), Expect = 9.0e-17 Identity = 48/58 (82.76%), Postives = 51/58 (87.93%), Query Frame = -2
BLAST of CU135566 vs. NCBI nr
Match: gi|700189566|gb|KGN44799.1| (hypothetical protein Csa_7G388320 [Cucumis sativus]) HSP 1 Score: 92.4 bits (228), Expect = 3.8e-16 Identity = 48/58 (82.76%), Postives = 51/58 (87.93%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|