CU134272 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTAATCGAGGCTCCCAAGATGATAAAGACCGCAGCCTCAGTTCCATGTCTCAGGGTCAATTCCGGCATAATCAACCCCGGCGACGTCGGCAGAATCGTGTCGAGAAAACCTAAGGACGTGTGGGCCGTGCGGCTTAAGGTCGGGACTTACCTCATAGATGGAAGGTATTTTAGAGCATTAGAACTCGATCAATAGCTTTAACTTGTCCGGAGAGGCTTTCGATTTGAAGGTTCCGAGCTTACAAATTCACCTTTCATGGCG
BLAST of CU134272 vs. TrEMBL
Match: A0A0A0L1Q6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G279890 PE=4 SV=1) HSP 1 Score: 130.6 bits (327), Expect = 9.5e-28 Identity = 64/64 (100.00%), Postives = 64/64 (100.00%), Query Frame = 1
BLAST of CU134272 vs. TrEMBL
Match: W9RP34_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_000099 PE=4 SV=1) HSP 1 Score: 118.6 bits (296), Expect = 3.7e-24 Identity = 53/64 (82.81%), Postives = 62/64 (96.88%), Query Frame = 1
BLAST of CU134272 vs. TrEMBL
Match: A0A0F7J2C1_9ROSI (Chlororespiratory reduction 42 OS=Hypseocharis bilobata GN=crr42 PE=2 SV=1) HSP 1 Score: 117.1 bits (292), Expect = 1.1e-23 Identity = 54/64 (84.38%), Postives = 60/64 (93.75%), Query Frame = 1
BLAST of CU134272 vs. TrEMBL
Match: A0A0D2SCG4_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_007G016000 PE=4 SV=1) HSP 1 Score: 116.7 bits (291), Expect = 1.4e-23 Identity = 52/64 (81.25%), Postives = 60/64 (93.75%), Query Frame = 1
BLAST of CU134272 vs. TrEMBL
Match: A0A0F7J567_PELHO (Chlororespiratory reduction 42 OS=Pelargonium hortorum GN=crr42 PE=2 SV=1) HSP 1 Score: 115.9 bits (289), Expect = 2.4e-23 Identity = 52/64 (81.25%), Postives = 61/64 (95.31%), Query Frame = 1
BLAST of CU134272 vs. NCBI nr
Match: gi|449448996|ref|XP_004142251.1| (PREDICTED: uncharacterized protein LOC101219406 [Cucumis sativus]) HSP 1 Score: 133.3 bits (334), Expect = 2.1e-28 Identity = 64/64 (100.00%), Postives = 64/64 (100.00%), Query Frame = 1
BLAST of CU134272 vs. NCBI nr
Match: gi|659097820|ref|XP_008449832.1| (PREDICTED: uncharacterized protein LOC103491596 [Cucumis melo]) HSP 1 Score: 133.3 bits (334), Expect = 2.1e-28 Identity = 64/64 (100.00%), Postives = 64/64 (100.00%), Query Frame = 1
BLAST of CU134272 vs. NCBI nr
Match: gi|703097269|ref|XP_010096070.1| (hypothetical protein L484_000626 [Morus notabilis]) HSP 1 Score: 121.3 bits (303), Expect = 8.2e-25 Identity = 53/64 (82.81%), Postives = 62/64 (96.88%), Query Frame = 1
BLAST of CU134272 vs. NCBI nr
Match: gi|821160374|gb|AKH05240.1| (chlororespiratory reduction 42 [Hypseocharis bilobata]) HSP 1 Score: 119.8 bits (299), Expect = 2.4e-24 Identity = 54/64 (84.38%), Postives = 60/64 (93.75%), Query Frame = 1
BLAST of CU134272 vs. NCBI nr
Match: gi|823182718|ref|XP_012488605.1| (PREDICTED: uncharacterized protein LOC105801837 isoform X1 [Gossypium raimondii]) HSP 1 Score: 119.4 bits (298), Expect = 3.1e-24 Identity = 52/64 (81.25%), Postives = 60/64 (93.75%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|