CU134016 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGATTTTATTTATTTTTTTCTCCATTTTCCCCTTCCCCACTCTCTCCAGTACCTGCTCCTCGCTTTTACGCCTGCAAGGAGCCGGTAAATTCCCTTCCCGGCTCTTTCCGGTACTCCGCCACCGCTATTTTTTTCTGATTTACA
BLAST of CU134016 vs. TrEMBL
Match: A0A0A0KU19_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G010970 PE=4 SV=1) HSP 1 Score: 68.6 bits (166), Expect = 2.5e-09 Identity = 32/32 (100.00%), Postives = 32/32 (100.00%), Query Frame = -1
BLAST of CU134016 vs. NCBI nr
Match: gi|700197840|gb|KGN52998.1| (hypothetical protein Csa_4G010970 [Cucumis sativus]) HSP 1 Score: 68.2 bits (165), Expect = 4.8e-09 Identity = 32/32 (100.00%), Postives = 32/32 (100.00%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|