CU133816 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTGAGGTGCCTTCGATTAAGGATGTGAACAATGAAGAACCTCTTTTTCCGGCTGTACCACTTCTTAATAGAAAGCTTGCATGTGATGAGCCAAAGTTGAGCTTACTATCT
BLAST of CU133816 vs. NCBI nr
Match: gi|778680559|ref|XP_011651345.1| (PREDICTED: protein root UVB sensitive 1, chloroplastic [Cucumis sativus]) HSP 1 Score: 75.5 bits (184), Expect = 2.1e-11 Identity = 36/36 (100.00%), Postives = 36/36 (100.00%), Query Frame = 3
BLAST of CU133816 vs. NCBI nr
Match: gi|659098056|ref|XP_008449956.1| (PREDICTED: UPF0420 protein C16orf58 homolog [Cucumis melo]) HSP 1 Score: 67.4 bits (163), Expect = 5.8e-09 Identity = 31/36 (86.11%), Postives = 33/36 (91.67%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|