CU132885 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTCCATGGTTCAACAAATAATGCACAACTTTCGCCCCCATTTTAAGACTGGACTGTCTTTCCAGTACCTTCTCTATGCGCACCAATGTATTCTCAGTTTTCAAACTTTCAAAAGTTCCGTCACAGGATTTAGATAGTTTGAGCTTATCCTTGACAATATCAATATTTTACTATGCACGAGGAATGAACATCTCCACCATTCACGTGTATATCAATTACGTTATGGCAAGTCAAGCGAGCATGG
BLAST of CU132885 vs. TrEMBL
Match: A0A0A0KVQ5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G095580 PE=4 SV=1) HSP 1 Score: 110.5 bits (275), Expect = 9.3e-22 Identity = 55/55 (100.00%), Postives = 55/55 (100.00%), Query Frame = -3
BLAST of CU132885 vs. TrEMBL
Match: A0A0A0KVQ5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G095580 PE=4 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 4.2e-06 Identity = 25/25 (100.00%), Postives = 25/25 (100.00%), Query Frame = -2
BLAST of CU132885 vs. NCBI nr
Match: gi|778691787|ref|XP_011653351.1| (PREDICTED: uncharacterized protein LOC101221126 [Cucumis sativus]) HSP 1 Score: 110.5 bits (275), Expect = 1.3e-21 Identity = 55/55 (100.00%), Postives = 55/55 (100.00%), Query Frame = -3
BLAST of CU132885 vs. NCBI nr
Match: gi|700198490|gb|KGN53648.1| (hypothetical protein Csa_4G095580 [Cucumis sativus]) HSP 1 Score: 110.5 bits (275), Expect = 1.3e-21 Identity = 55/55 (100.00%), Postives = 55/55 (100.00%), Query Frame = -3
BLAST of CU132885 vs. NCBI nr
Match: gi|659111138|ref|XP_008455598.1| (PREDICTED: uncharacterized protein LOC103495734 isoform X1 [Cucumis melo]) HSP 1 Score: 98.6 bits (244), Expect = 5.3e-18 Identity = 49/55 (89.09%), Postives = 52/55 (94.55%), Query Frame = -3
BLAST of CU132885 vs. NCBI nr
Match: gi|659111140|ref|XP_008455600.1| (PREDICTED: uncharacterized protein LOC103495734 isoform X2 [Cucumis melo]) HSP 1 Score: 98.6 bits (244), Expect = 5.3e-18 Identity = 49/55 (89.09%), Postives = 52/55 (94.55%), Query Frame = -3
BLAST of CU132885 vs. NCBI nr
Match: gi|659111142|ref|XP_008455601.1| (PREDICTED: uncharacterized protein LOC103495734 isoform X3 [Cucumis melo]) HSP 1 Score: 98.6 bits (244), Expect = 5.3e-18 Identity = 49/55 (89.09%), Postives = 52/55 (94.55%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|