CU132858 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AAGATGAAGAGGACAACAGCTGAATTTGCTAACAGAGTCTCTGAAATCTCTGTCATTTCTCCTCTCATTTGACTTCTTGGAACATTCATATCTTGAACAACTTTCTTCTTGGGAGAAGAGACTTGTTTCTTGGAGAAGGATTGAAGCTGTTGATCAAGCTCTTGAAGGGCCTGCCTAGCCTTATCTGGGTCAACCTCAAACTGTTGAGAATCCGACTCCCTTGCACACAAA
BLAST of CU132858 vs. TrEMBL
Match: A0A0A0KH36_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G439950 PE=4 SV=1) HSP 1 Score: 108.6 bits (270), Expect = 3.4e-21 Identity = 58/76 (76.32%), Postives = 59/76 (77.63%), Query Frame = -2
BLAST of CU132858 vs. NCBI nr
Match: gi|778717033|ref|XP_011657640.1| (PREDICTED: uncharacterized protein LOC101220685 [Cucumis sativus]) HSP 1 Score: 105.5 bits (262), Expect = 4.1e-20 Identity = 58/76 (76.32%), Postives = 59/76 (77.63%), Query Frame = -2
BLAST of CU132858 vs. NCBI nr
Match: gi|659097587|ref|XP_008449706.1| (PREDICTED: uncharacterized protein LOC103491505 [Cucumis melo]) HSP 1 Score: 100.9 bits (250), Expect = 1.0e-18 Identity = 56/76 (73.68%), Postives = 57/76 (75.00%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|