|
The following sequences are available for this feature:
transcribed_cluster sequence CGGCCGGGGACCAAGAGAACGTCCGTCCGTACCACACTCCTAAATCTCTACTCTCAACGCATAGTAATCCCCAAACTCTTACAACAATGATTTCCTCCAAGAGGCCAAGAACATGCCGTAATTTCACCGTAGATTCTGATCTATTCGATGTCTTGCCCGACGATCTCCTTATACATCTCCTCTCTCGCCTTGCCGCCTCCGCCTCCTCCCCTCCTGACCTCCTCAACCTTCTCTTGACATGTAAGAGGTTGAATC
The following BLAST results are available for this feature:
Match Name | E-value | Identity | Description | |
The following terms have been associated with this transcribed_cluster:
Vocabulary: INTERPRO
Term | Definition |
IPR001810 | F-box_dom |
Vocabulary: Molecular Function
Term | Definition |
GO:0005515 | protein binding |
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
Category |
Term Accession |
Term Name |
molecular_function |
GO:0005515 |
protein binding |
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
IPR Term | IPR Description | Source | Source Term | Source Description | Alignment |
IPR001810 | F-box domain | unknown | SSF81383 | F-box domain | coord: 43..85 score: 1.1 |
None | No IPR available | GENE3D | G3DSA:1.20.1280.50 | | coord: 45..85 score: 5. |
None | No IPR available | PANTHER | PTHR12298 | PCDC2 PROGRAMMED CELL DEATH PROTEIN 2 -RELATED | coord: 40..85 score: 6.0 |
None | No IPR available | PANTHER | PTHR12298:SF7 | SUBFAMILY NOT NAMED | coord: 40..85 score: 6.0 |
|