CU131792 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGACGATTCCAATGGCTGCTTATCTTCCTCCTACAACACCATTCTCGCGCCCCAACATTAGAATCCTCACTTCCATCTCTTCCTTCAACGTTTCCAACACTCTGACCACTCGTTCACAACCGCGAAGCATCGTGAAATGCGAATCCAGTGCATCGCCAGCAGACGGCCAGACGCCGCCGCCAAAAAGTCAGAAACTCGAGATCGGGTCCCCCGTTATCGTAATCGAGGCTCCCAAG
BLAST of CU131792 vs. TrEMBL
Match: A0A0A0L1Q6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G279890 PE=4 SV=1) HSP 1 Score: 147.5 bits (371), Expect = 7.0e-33 Identity = 74/75 (98.67%), Postives = 74/75 (98.67%), Query Frame = 1
BLAST of CU131792 vs. NCBI nr
Match: gi|449448996|ref|XP_004142251.1| (PREDICTED: uncharacterized protein LOC101219406 [Cucumis sativus]) HSP 1 Score: 141.4 bits (355), Expect = 7.2e-31 Identity = 74/75 (98.67%), Postives = 74/75 (98.67%), Query Frame = 1
BLAST of CU131792 vs. NCBI nr
Match: gi|659097820|ref|XP_008449832.1| (PREDICTED: uncharacterized protein LOC103491596 [Cucumis melo]) HSP 1 Score: 120.6 bits (301), Expect = 1.3e-24 Identity = 65/75 (86.67%), Postives = 67/75 (89.33%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|