CU131592 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GCCCGGTACTTCAGGCTGGGAATTTTCGACTTTCTTCTCTGTCAAGTTTTGCTTGTTCTTGTTACAGTGAGTTTCTTCCCCATTGGAGACCTTTCCATCATCAATTTTGCCGGATTCTTCACCGACTGGTACCGATTTCTCGATCAGTAGACCGACAAAAGGTACAGAAGAGTCTTTGCCCAAAGCTTCATTCGAGAGCTTCAACCTCTTTGATGCCGATTCAGCTTCTCCATCAGTACCAGACTCCGAAACCTTG
BLAST of CU131592 vs. TrEMBL
Match: A0A0A0LT00_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G042410 PE=4 SV=1) HSP 1 Score: 170.2 bits (430), Expect = 1.1e-39 Identity = 85/85 (100.00%), Postives = 85/85 (100.00%), Query Frame = -2
BLAST of CU131592 vs. NCBI nr
Match: gi|700209033|gb|KGN64129.1| (hypothetical protein Csa_1G042410 [Cucumis sativus]) HSP 1 Score: 161.4 bits (407), Expect = 7.0e-37 Identity = 85/85 (100.00%), Postives = 85/85 (100.00%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|