CU130764 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGACGATGGGATGGGACCCGACCAATTATCGGAAACCAAATCAATTTTGATTTATTTTTTTGCATTGCTGTCGAGGATTCGAATTCTCTTACTTGCACGTTTTCTTGCGATGATATTCTCTGGTACTCACTCATCGGAGGATAAAGTTCGCTTCCGTTAAGCCATGTGAACTCCTTATCAGAAGCACATAAGGAAGGCAAGCTACGCATTGAAAGCTTGGAGAAGGAATTGACAAACTGCACCGAGGAAA
BLAST of CU130764 vs. TrEMBL
Match: A0A0A0LVL0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G039030 PE=4 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 9.7e-14 Identity = 44/60 (73.33%), Postives = 45/60 (75.00%), Query Frame = 1
BLAST of CU130764 vs. NCBI nr
Match: gi|700208940|gb|KGN64036.1| (hypothetical protein Csa_1G039030 [Cucumis sativus]) HSP 1 Score: 82.8 bits (203), Expect = 3.1e-13 Identity = 44/60 (73.33%), Postives = 45/60 (75.00%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|