CU129802 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGGAAGAGAGAAGGATGTGTGAAGAAGAGTGAGAGAGGGAGAGAGGAGGTGAGATAGAGAAATTGGGAGATGGTGTGAGTGTGAGAGAAAGAAGCAAGAGATACTGAGAAAACAATGGCATGAGTGGTTTAGAAGGGCAAGACCATGACATAAGGGCGAGACTAGCTAAACAGATAGCAACGAGGCTAGGAGGAGAGCAACACCAAGCACACATAGTTTT
BLAST of CU129802 vs. TrEMBL
Match: A0A0A0LVL4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G171060 PE=4 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 5.5e-08 Identity = 31/33 (93.94%), Postives = 32/33 (96.97%), Query Frame = 1
BLAST of CU129802 vs. NCBI nr
Match: gi|700209888|gb|KGN64984.1| (hypothetical protein Csa_1G171060 [Cucumis sativus]) HSP 1 Score: 64.7 bits (156), Expect = 7.9e-08 Identity = 31/33 (93.94%), Postives = 32/33 (96.97%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|