CU129635 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGGCTTAATCTGGGGATTAAGGCTATTATAATATGTTTCACTCCTCCCAACTCCATGCGTGCTCCACGTCTTTCCTTCGTACTCCATCTTGTACTCCTCTCCAACTCCACGCCATACTCCACCTCTTGCTTCTCTTCTGGCTTTCCATTTCCACTTCTCTCATTCATCTCCTCCCAATTTTCCCCAATAGTGTCAGTCATCGGAAACTACTTAGGTCAAGAAGAATCCACAGAACTCTCCGCAATTT
BLAST of CU129635 vs. TrEMBL
Match: A0A0A0LAB2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G213490 PE=4 SV=1) HSP 1 Score: 137.1 bits (344), Expect = 9.8e-30 Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = -3
BLAST of CU129635 vs. NCBI nr
Match: gi|700202424|gb|KGN57557.1| (hypothetical protein Csa_3G213490 [Cucumis sativus]) HSP 1 Score: 134.8 bits (338), Expect = 6.9e-29 Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|