CU129122 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGATTGTCACTTTATAATAATGGTGAGTTCTAAGAACAAGGGTCGGTGGCAGTGGGCTTCTGGTGGCCGTTGCGGCAGTGGCGATACTGCTGGCGGCGGTGCCGGAAGTCTCGGCGACGGTGGACTGTCGGTGGCAACATGGGTTGGAATACTAATGTGAACTATACTACCTGGGCTCAGGGAAAGCACTTCTATTATGATGATTGGCTCTTTTTTGTGTATGACAGGAACCAAATGAATGTG
BLAST of CU129122 vs. Swiss-Prot
Match: LAML_ARATH (Lamin-like protein OS=Arabidopsis thaliana GN=At5g15350 PE=1 SV=1) HSP 1 Score: 71.2 bits (173), Expect = 5.8e-12 Identity = 28/40 (70.00%), Postives = 30/40 (75.00%), Query Frame = 1
BLAST of CU129122 vs. TrEMBL
Match: A0A0A0LC11_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G824220 PE=4 SV=1) HSP 1 Score: 96.7 bits (239), Expect = 1.4e-17 Identity = 40/40 (100.00%), Postives = 40/40 (100.00%), Query Frame = 1
BLAST of CU129122 vs. TrEMBL
Match: A0A0A0LC11_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G824220 PE=4 SV=1) HSP 1 Score: 30.4 bits (67), Expect = 1.3e+03 Identity = 19/39 (48.72%), Postives = 19/39 (48.72%), Query Frame = 3
HSP 2 Score: 86.3 bits (212), Expect = 2.0e-14 Identity = 35/40 (87.50%), Postives = 36/40 (90.00%), Query Frame = 1
BLAST of CU129122 vs. TrEMBL
Match: Q2HW94_MEDTR (Blue (Type 1) copper domain OS=Medicago truncatula GN=MTR_6g013420 PE=2 SV=1) HSP 1 Score: 82.8 bits (203), Expect = 2.2e-13 Identity = 34/39 (87.18%), Postives = 35/39 (89.74%), Query Frame = 1
BLAST of CU129122 vs. TrEMBL
Match: A9PAA9_POPTR (Plastocyanin-like domain-containing family protein OS=Populus trichocarpa GN=POPTR_0017s12460g PE=2 SV=1) HSP 1 Score: 81.6 bits (200), Expect = 4.8e-13 Identity = 33/40 (82.50%), Postives = 35/40 (87.50%), Query Frame = 1
BLAST of CU129122 vs. TrEMBL
Match: D7SXH0_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_14s0108g01320 PE=4 SV=1) HSP 1 Score: 80.5 bits (197), Expect = 1.1e-12 Identity = 33/40 (82.50%), Postives = 35/40 (87.50%), Query Frame = 1
BLAST of CU129122 vs. NCBI nr
Match: gi|449437808|ref|XP_004136682.1| (PREDICTED: lamin-like protein [Cucumis sativus]) HSP 1 Score: 94.7 bits (234), Expect = 7.9e-17 Identity = 40/40 (100.00%), Postives = 40/40 (100.00%), Query Frame = 1
BLAST of CU129122 vs. NCBI nr
Match: gi|659085323|ref|XP_008443359.1| (PREDICTED: lamin-like protein [Cucumis melo]) HSP 1 Score: 90.9 bits (224), Expect = 1.1e-15 Identity = 38/40 (95.00%), Postives = 39/40 (97.50%), Query Frame = 1
BLAST of CU129122 vs. NCBI nr
Match: gi|703073526|ref|XP_010089568.1| (Lamin-like protein [Morus notabilis]) HSP 1 Score: 84.3 bits (207), Expect = 1.1e-13 Identity = 35/40 (87.50%), Postives = 36/40 (90.00%), Query Frame = 1
BLAST of CU129122 vs. NCBI nr
Match: gi|357496611|ref|XP_003618594.1| (blue copper-like protein [Medicago truncatula]) HSP 1 Score: 80.9 bits (198), Expect = 1.2e-12 Identity = 34/39 (87.18%), Postives = 35/39 (89.74%), Query Frame = 1
BLAST of CU129122 vs. NCBI nr
Match: gi|502091076|ref|XP_004489434.1| (PREDICTED: lamin-like protein [Cicer arietinum]) HSP 1 Score: 80.9 bits (198), Expect = 1.2e-12 Identity = 34/39 (87.18%), Postives = 35/39 (89.74%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|