CU128966 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGGAAAAAGGCTTCTGCGCAAGAAAGAAACACTCGTTTTTCTCCCTCCCGCCATTGCTCGAAGCTTCCTGTCTACTTTGTCTGTATTTTACGCACAAAGGCAATGGCTACTGAAGAAGACTCCGTGGAACAAGTTGCTGCAGCACGTAAAGAGAGATTGAAAGCTCTAAGAGCTGCTCAGGAATTGTTAAACAATTCAGATGAGAAGAATTCTGGAGGAGAGGATAAAGAGAATGGAGCT
BLAST of CU128966 vs. TrEMBL
Match: A0A0A0LR08_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G043260 PE=4 SV=1) HSP 1 Score: 72.4 bits (176), Expect = 2.9e-10 Identity = 39/59 (66.10%), Postives = 41/59 (69.49%), Query Frame = 2
BLAST of CU128966 vs. TrEMBL
Match: A0A0A0LR08_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G043260 PE=4 SV=1) HSP 1 Score: 60.1 bits (144), Expect = 1.5e-06 Identity = 26/27 (96.30%), Postives = 27/27 (100.00%), Query Frame = 1
BLAST of CU128966 vs. NCBI nr
Match: gi|700209127|gb|KGN64223.1| (hypothetical protein Csa_1G043260 [Cucumis sativus]) HSP 1 Score: 69.7 bits (169), Expect = 2.7e-09 Identity = 39/59 (66.10%), Postives = 41/59 (69.49%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|