CU128937 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CCTTAAAAGCGGCCTTTCTCAACCAAACTAAATTTAGTTTGTAAGTCAAACTTTGGTTGTGGCTTTCACCTCTCTGCTTTGCAATGAAAACTGCTTGCACTTTTCTAGGCATTTTGCTGTCTTTT
BLAST of CU128937 vs. NCBI nr
Match: gi|778706736|ref|XP_011655905.1| (PREDICTED: LOW QUALITY PROTEIN: annexin D3 [Cucumis sativus]) HSP 1 Score: 57.4 bits (137), Expect = 6.9e-06 Identity = 32/41 (78.05%), Postives = 33/41 (80.49%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|