CU128844 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTAAAAGATTTGAAACCTTTTCTGATTCTCTTTCGGCTTAAATGCAGGGAATGCCCTGGCGAAGTTAAGGAGGCGATATCGAGTCTGATATTTGCAGCTTCAAGGTGCGGAGAGTTTCCAGAACTTCAAGAGATTCGTCGGATTTTCGAGTTGAAGTTTGGTGCGGAGTTTGCAAGCAGTGCCATTGATTTACGCAACAACTGCGGTGTTAGTACCAAGGTGAGTTTTGATACTTACCAA
BLAST of CU128844 vs. TrEMBL
Match: A0A0A0L6Y2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G271380 PE=4 SV=1) HSP 1 Score: 117.9 bits (294), Expect = 5.8e-24 Identity = 60/67 (89.55%), Postives = 62/67 (92.54%), Query Frame = 1
BLAST of CU128844 vs. TrEMBL
Match: B9RSL0_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_1725700 PE=4 SV=1) HSP 1 Score: 95.1 bits (235), Expect = 4.0e-17 Identity = 46/61 (75.41%), Postives = 53/61 (86.89%), Query Frame = 1
BLAST of CU128844 vs. TrEMBL
Match: M1AZM5_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400012974 PE=4 SV=1) HSP 1 Score: 93.6 bits (231), Expect = 1.2e-16 Identity = 43/57 (75.44%), Postives = 51/57 (89.47%), Query Frame = 1
BLAST of CU128844 vs. TrEMBL
Match: K4BXC9_SOLLC (Uncharacterized protein OS=Solanum lycopersicum PE=4 SV=1) HSP 1 Score: 93.2 bits (230), Expect = 1.5e-16 Identity = 43/57 (75.44%), Postives = 51/57 (89.47%), Query Frame = 1
BLAST of CU128844 vs. TrEMBL
Match: A0A0D2SGK7_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_005G138400 PE=4 SV=1) HSP 1 Score: 92.4 bits (228), Expect = 2.6e-16 Identity = 41/59 (69.49%), Postives = 51/59 (86.44%), Query Frame = 1
BLAST of CU128844 vs. NCBI nr
Match: gi|778680671|ref|XP_011651370.1| (PREDICTED: uncharacterized protein LOC105434874 isoform X2 [Cucumis sativus]) HSP 1 Score: 120.2 bits (300), Expect = 1.7e-24 Identity = 60/67 (89.55%), Postives = 62/67 (92.54%), Query Frame = 1
BLAST of CU128844 vs. NCBI nr
Match: gi|778680668|ref|XP_011651369.1| (PREDICTED: uncharacterized protein LOC105434874 isoform X1 [Cucumis sativus]) HSP 1 Score: 120.2 bits (300), Expect = 1.7e-24 Identity = 60/67 (89.55%), Postives = 62/67 (92.54%), Query Frame = 1
BLAST of CU128844 vs. NCBI nr
Match: gi|659123287|ref|XP_008461584.1| (PREDICTED: uncharacterized protein LOC103500154 [Cucumis melo]) HSP 1 Score: 116.3 bits (290), Expect = 2.4e-23 Identity = 60/73 (82.19%), Postives = 64/73 (87.67%), Query Frame = 1
BLAST of CU128844 vs. NCBI nr
Match: gi|747098358|ref|XP_011097187.1| (PREDICTED: uncharacterized protein LOC105176162 [Sesamum indicum]) HSP 1 Score: 98.6 bits (244), Expect = 5.3e-18 Identity = 45/59 (76.27%), Postives = 50/59 (84.75%), Query Frame = 1
BLAST of CU128844 vs. NCBI nr
Match: gi|255551366|ref|XP_002516729.1| (PREDICTED: IST1-like protein isoform X1 [Ricinus communis]) HSP 1 Score: 97.1 bits (240), Expect = 1.5e-17 Identity = 46/61 (75.41%), Postives = 53/61 (86.89%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|