CU128791 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ACGAAAAAGGTAAAAATGCAATAACAAAACAAAACTTTCAAGTTAAATTTCGAAATCTTCCTATATTATGACCAACACAGTAACATAGTACATTTTGTGCAGTTGAAATGAAAGATGCAAGTGGTATGGGAGATGTCTCACACAAGAAGTCGCCAAGTCGTGACAGCGTTGAGAGCACCACTAGTGCAAAATGT
BLAST of CU128791 vs. TrEMBL
Match: A0A0A0LNT2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G000760 PE=4 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 3.6e-08 Identity = 31/31 (100.00%), Postives = 31/31 (100.00%), Query Frame = 3
BLAST of CU128791 vs. NCBI nr
Match: gi|778655250|ref|XP_011649820.1| (PREDICTED: probable DNA-directed RNA polymerase I subunit RPA43 [Cucumis sativus]) HSP 1 Score: 63.2 bits (152), Expect = 2.0e-07 Identity = 31/31 (100.00%), Postives = 31/31 (100.00%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|