CU127981 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGACGACTCAGCCGTCTGGGATTCCCGAGCTCCACCGTCTCCTCAACTTCGAGTTCGACGTTGCACCCAAACCAATGAAGAAGAATCGGTAGGAAGTGGTCATCGAAAAACCCAATTTCTAGAAGTCTCCAACTGATGCTCTTCATCTTGCTATGATACAATCAACCTTCATCCGCCCAAAAATCTTAGCCAAAGCGATGTCAATATGTTACTAATTACAAAAGGAAAACTGGAAACTGTGTTAAATAGTACTTTAGAAA
BLAST of CU127981 vs. TrEMBL
Match: A0A0A0LUT0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G089480 PE=4 SV=1) HSP 1 Score: 92.0 bits (227), Expect = 3.8e-16 Identity = 43/43 (100.00%), Postives = 43/43 (100.00%), Query Frame = 3
BLAST of CU127981 vs. NCBI nr
Match: gi|700209663|gb|KGN64759.1| (hypothetical protein Csa_1G089480 [Cucumis sativus]) HSP 1 Score: 91.7 bits (226), Expect = 7.1e-16 Identity = 43/43 (100.00%), Postives = 43/43 (100.00%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|