CU127334 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGAGAAGATGGGTGATTATAGGTGTTGCCCAGATACGTTATCATTCAATAATTTGATCGAACAATTATGTAATAATGGAATGTTGGCTGAAGCTGAGATGCTTTACGGAACAATGGATGATAAGGGAGTAAACCCGGACGAGTTTACTATGGTTTGTTGATGGATTCTTGCTTTAAAAAAAACAGGGCAGATGATGCAGCTGCATATTTTAGAAAAATGGTAGATTCTGGACTCAGACCCAA
BLAST of CU127334 vs. Swiss-Prot
Match: PP273_ARATH (Pentatricopeptide repeat-containing protein At3g49240 OS=Arabidopsis thaliana GN=EMB1796 PE=2 SV=1) HSP 1 Score: 76.3 bits (186), Expect = 1.8e-13 Identity = 32/48 (66.67%), Postives = 39/48 (81.25%), Query Frame = 3
HSP 2 Score: 51.2 bits (121), Expect = 6.2e-06 Identity = 21/37 (56.76%), Postives = 26/37 (70.27%), Query Frame = 2
BLAST of CU127334 vs. TrEMBL
Match: A0A0A0L7B2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G239860 PE=4 SV=1) HSP 1 Score: 109.0 bits (271), Expect = 2.8e-21 Identity = 49/49 (100.00%), Postives = 49/49 (100.00%), Query Frame = 3
BLAST of CU127334 vs. TrEMBL
Match: A0A0A0L7B2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G239860 PE=4 SV=1) HSP 1 Score: 70.5 bits (171), Expect = 1.1e-09 Identity = 33/39 (84.62%), Postives = 33/39 (84.62%), Query Frame = 2
HSP 2 Score: 99.4 bits (246), Expect = 2.2e-18 Identity = 45/49 (91.84%), Postives = 47/49 (95.92%), Query Frame = 3
BLAST of CU127334 vs. TrEMBL
Match: E5GB98_CUCME (Pentatricopeptide repeat-containing protein OS=Cucumis melo subsp. melo PE=4 SV=1) HSP 1 Score: 66.2 bits (160), Expect = 2.1e-08 Identity = 31/39 (79.49%), Postives = 32/39 (82.05%), Query Frame = 2
HSP 2 Score: 90.5 bits (223), Expect = 1.0e-15 Identity = 42/50 (84.00%), Postives = 43/50 (86.00%), Query Frame = 3
BLAST of CU127334 vs. TrEMBL
Match: M5X3R7_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa002582mg PE=4 SV=1) HSP 1 Score: 55.8 bits (133), Expect = 2.8e-05 Identity = 26/39 (66.67%), Postives = 30/39 (76.92%), Query Frame = 2
HSP 2 Score: 89.7 bits (221), Expect = 1.7e-15 Identity = 40/48 (83.33%), Postives = 43/48 (89.58%), Query Frame = 3
BLAST of CU127334 vs. TrEMBL
Match: V4TWN7_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10019365mg PE=4 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 1.1e-06 Identity = 27/39 (69.23%), Postives = 29/39 (74.36%), Query Frame = 2
HSP 2 Score: 89.7 bits (221), Expect = 1.7e-15 Identity = 40/48 (83.33%), Postives = 43/48 (89.58%), Query Frame = 3
BLAST of CU127334 vs. NCBI nr
Match: gi|449456969|ref|XP_004146221.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g49240 [Cucumis sativus]) HSP 1 Score: 111.7 bits (278), Expect = 6.1e-22 Identity = 49/49 (100.00%), Postives = 49/49 (100.00%), Query Frame = 3
BLAST of CU127334 vs. NCBI nr
Match: gi|659133624|ref|XP_008466825.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g49240 [Cucumis melo]) HSP 1 Score: 102.1 bits (253), Expect = 4.9e-19 Identity = 45/49 (91.84%), Postives = 47/49 (95.92%), Query Frame = 3
BLAST of CU127334 vs. NCBI nr
Match: gi|694447816|ref|XP_009349953.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g49240-like [Pyrus x bretschneideri]) HSP 1 Score: 93.6 bits (231), Expect = 1.7e-16 Identity = 42/50 (84.00%), Postives = 43/50 (86.00%), Query Frame = 3
BLAST of CU127334 vs. NCBI nr
Match: gi|1009123239|ref|XP_015878436.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g49240 [Ziziphus jujuba]) HSP 1 Score: 93.6 bits (231), Expect = 1.7e-16 Identity = 41/50 (82.00%), Postives = 43/50 (86.00%), Query Frame = 3
BLAST of CU127334 vs. NCBI nr
Match: gi|694321736|ref|XP_009352022.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g49240-like [Pyrus x bretschneideri]) HSP 1 Score: 93.6 bits (231), Expect = 1.7e-16 Identity = 42/50 (84.00%), Postives = 43/50 (86.00%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|