CU126364 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGACACCTTTCAATACAATTACAAAAATAAAATAAAAATAAAAAAAACCAAAAAACCTACTGTTTTTCTTTCAAAGAAAAGCAAAAAAAGGAAAATAGGATGGTTTGATTCCATTGTTCTACAGAGCGATGAAGAAAAATAGAAGGAGAAGGCAGTATACAGTGCTTTCCACAAAAGCAGAATCAGAAGCAGAAACGGAAGCAGCTTCTTTATCTTTCAACATTGCTGATTTCTATGTGGATCCCCCTTCAATCAAATCTGAGGGCAGGGCTTACCG
BLAST of CU126364 vs. TrEMBL
Match: A0A0A0LL24_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G123040 PE=4 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 1.4e-13 Identity = 42/59 (71.19%), Postives = 42/59 (71.19%), Query Frame = 1
BLAST of CU126364 vs. NCBI nr
Match: gi|449442349|ref|XP_004138944.1| (PREDICTED: uncharacterized protein LOC101210346 [Cucumis sativus]) HSP 1 Score: 84.3 bits (207), Expect = 1.2e-13 Identity = 42/59 (71.19%), Postives = 42/59 (71.19%), Query Frame = 1
BLAST of CU126364 vs. NCBI nr
Match: gi|659082088|ref|XP_008441665.1| (PREDICTED: uncharacterized protein LOC103485749 [Cucumis melo]) HSP 1 Score: 82.0 bits (201), Expect = 6.0e-13 Identity = 40/59 (67.80%), Postives = 41/59 (69.49%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|