CU125727 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGGAGACACAATCTACATTAGTTTACATCTTTTATAATTTTCCTTCGGAACGCATCGGTTCTTGTTAGATTTCTTTTCCGATCAAGACTAAACCATGGCGACAGCTACCTATCCACCACCACCTCCATTTTACAAGCTCTACAAAGATTACCTGCAGGATCCGAAATCGGCACCGGAGCCTCCTCCGCCCATCGAAGGCACCTATATGTGCTTTGGTAGCAATTACACCACGGATGACGTGCTTCCAAGTTTGGAAG
BLAST of CU125727 vs. Swiss-Prot
Match: MED7A_ARATH (Mediator of RNA polymerase II transcription subunit 7a OS=Arabidopsis thaliana GN=MED7A PE=1 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 3.2e-13 Identity = 34/54 (62.96%), Postives = 38/54 (70.37%), Query Frame = 3
BLAST of CU125727 vs. Swiss-Prot
Match: MED7B_ARATH (Mediator of RNA polymerase II transcription subunit 7b OS=Arabidopsis thaliana GN=MED7B PE=1 SV=1) HSP 1 Score: 70.5 bits (171), Expect = 1.0e-11 Identity = 32/54 (59.26%), Postives = 37/54 (68.52%), Query Frame = 3
BLAST of CU125727 vs. TrEMBL
Match: A0A0A0LBQ7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G791540 PE=4 SV=1) HSP 1 Score: 89.7 bits (221), Expect = 1.9e-15 Identity = 43/54 (79.63%), Postives = 43/54 (79.63%), Query Frame = 3
BLAST of CU125727 vs. TrEMBL
Match: W9QYU7_9ROSA (Putative mediator of RNA polymerase II transcription subunit 7 OS=Morus notabilis GN=L484_014057 PE=4 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 4.6e-14 Identity = 39/54 (72.22%), Postives = 43/54 (79.63%), Query Frame = 3
BLAST of CU125727 vs. TrEMBL
Match: M5W1M1_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa021222mg PE=4 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 1.0e-13 Identity = 38/54 (70.37%), Postives = 42/54 (77.78%), Query Frame = 3
BLAST of CU125727 vs. TrEMBL
Match: A0A0B0PJ64_GOSAR (Putative mediator of RNA polymerase II transcription subunit 7 OS=Gossypium arboreum GN=F383_07728 PE=4 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 1.3e-13 Identity = 39/54 (72.22%), Postives = 42/54 (77.78%), Query Frame = 3
BLAST of CU125727 vs. TrEMBL
Match: A0A0D2TSC4_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_007G362800 PE=4 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 1.3e-13 Identity = 39/54 (72.22%), Postives = 42/54 (77.78%), Query Frame = 3
BLAST of CU125727 vs. NCBI nr
Match: gi|449437536|ref|XP_004136548.1| (PREDICTED: mediator of RNA polymerase II transcription subunit 7a-like [Cucumis sativus]) HSP 1 Score: 91.7 bits (226), Expect = 7.0e-16 Identity = 43/54 (79.63%), Postives = 43/54 (79.63%), Query Frame = 3
BLAST of CU125727 vs. NCBI nr
Match: gi|703065823|ref|XP_010087552.1| (Putative mediator of RNA polymerase II transcription subunit 7 [Morus notabilis]) HSP 1 Score: 87.0 bits (214), Expect = 1.7e-14 Identity = 39/54 (72.22%), Postives = 43/54 (79.63%), Query Frame = 3
BLAST of CU125727 vs. NCBI nr
Match: gi|470135123|ref|XP_004303373.1| (PREDICTED: mediator of RNA polymerase II transcription subunit 7a-like [Fragaria vesca subsp. vesca]) HSP 1 Score: 86.7 bits (213), Expect = 2.2e-14 Identity = 39/54 (72.22%), Postives = 43/54 (79.63%), Query Frame = 3
BLAST of CU125727 vs. NCBI nr
Match: gi|1009161423|ref|XP_015898889.1| (PREDICTED: mediator of RNA polymerase II transcription subunit 7a [Ziziphus jujuba]) HSP 1 Score: 86.3 bits (212), Expect = 2.9e-14 Identity = 39/54 (72.22%), Postives = 42/54 (77.78%), Query Frame = 3
BLAST of CU125727 vs. NCBI nr
Match: gi|645271926|ref|XP_008241147.1| (PREDICTED: mediator of RNA polymerase II transcription subunit 7a-like [Prunus mume]) HSP 1 Score: 85.9 bits (211), Expect = 3.8e-14 Identity = 38/54 (70.37%), Postives = 42/54 (77.78%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|