CU124653 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGAACAGGAACAGATGTACAATTTTGGTAATTAATAGGTGATCAAGACAAGCTTAAGAAGTGGGCAGAGGCGTTTGATTGTGAGGTGGGTTCTCTCCCTTCTTCTTACCTTGGGCTTTTGTGGGTCCTAACTTGAGAGCTACGACATTTTGGAATCCAATTTGTGAGAAGATTCAAAAGAAGCTGGCAGTGTGGTGTAAGGGTTTTTCTCTAAAGCCGGCAGATAAACCTTGATTAGATCTGTGTTGAGTGGCTTTTTCACGG
BLAST of CU124653 vs. TrEMBL
Match: A0A0A0LYJ9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G701340 PE=4 SV=1) HSP 1 Score: 71.6 bits (174), Expect = 5.3e-10 Identity = 32/32 (100.00%), Postives = 32/32 (100.00%), Query Frame = 1
BLAST of CU124653 vs. NCBI nr
Match: gi|700211762|gb|KGN66858.1| (hypothetical protein Csa_1G701340 [Cucumis sativus]) HSP 1 Score: 74.3 bits (181), Expect = 1.2e-10 Identity = 32/32 (100.00%), Postives = 32/32 (100.00%), Query Frame = 1
BLAST of CU124653 vs. NCBI nr
Match: gi|700206250|gb|KGN61369.1| (hypothetical protein Csa_2G100020 [Cucumis sativus]) HSP 1 Score: 60.1 bits (144), Expect = 2.3e-06 Identity = 35/77 (45.45%), Postives = 43/77 (55.84%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|