CU124619 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGGGATGGTAAGAGGTGGCCGCAATCTGATGGCGCTGCCCGGAGATAGGTGCCGCCGGAATCAGGGAAGCAGAGAGGTTCTAAGAAGGGCTTTGATGCCGCCGAGCCGGAGACCCACACTCCGATGGATGAATTTCCGGCCAACTCCCAGTCGTCTTTCCATAATGTCTATGGCCGAAAGTTAATTGATTAATTTTGTTTTTTGGGATTATTCTTTGATTCTTATTCAACAAATTTCTGGGACTTTCTTTGTATGTATGG
BLAST of CU124619 vs. TrEMBL
Match: A0A0A0LD23_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G852440 PE=4 SV=1) HSP 1 Score: 127.9 bits (320), Expect = 6.2e-27 Identity = 61/61 (100.00%), Postives = 61/61 (100.00%), Query Frame = 3
BLAST of CU124619 vs. TrEMBL
Match: B9N1L2_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0001s41500g PE=4 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 3.7e-11 Identity = 36/58 (62.07%), Postives = 44/58 (75.86%), Query Frame = 3
BLAST of CU124619 vs. TrEMBL
Match: A0A072VBI5_MEDTR (Uncharacterized protein OS=Medicago truncatula GN=MTR_2g080030 PE=4 SV=1) HSP 1 Score: 73.2 bits (178), Expect = 1.8e-10 Identity = 34/58 (58.62%), Postives = 44/58 (75.86%), Query Frame = 3
BLAST of CU124619 vs. TrEMBL
Match: B9HZY7_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0011s12430g PE=4 SV=2) HSP 1 Score: 73.2 bits (178), Expect = 1.8e-10 Identity = 37/59 (62.71%), Postives = 46/59 (77.97%), Query Frame = 3
BLAST of CU124619 vs. TrEMBL
Match: B9T365_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_0129360 PE=4 SV=1) HSP 1 Score: 72.8 bits (177), Expect = 2.4e-10 Identity = 37/59 (62.71%), Postives = 45/59 (76.27%), Query Frame = 3
BLAST of CU124619 vs. NCBI nr
Match: gi|778688989|ref|XP_011652880.1| (PREDICTED: uncharacterized protein LOC105435142 [Cucumis sativus]) HSP 1 Score: 125.2 bits (313), Expect = 5.8e-26 Identity = 61/61 (100.00%), Postives = 61/61 (100.00%), Query Frame = 3
BLAST of CU124619 vs. NCBI nr
Match: gi|659109339|ref|XP_008454664.1| (PREDICTED: uncharacterized protein LOC103495017 [Cucumis melo]) HSP 1 Score: 124.0 bits (310), Expect = 1.3e-25 Identity = 60/61 (98.36%), Postives = 61/61 (100.00%), Query Frame = 3
BLAST of CU124619 vs. NCBI nr
Match: gi|566154106|ref|XP_006370308.1| (hypothetical protein POPTR_0001s41500g [Populus trichocarpa]) HSP 1 Score: 72.8 bits (177), Expect = 3.4e-10 Identity = 36/58 (62.07%), Postives = 44/58 (75.86%), Query Frame = 3
BLAST of CU124619 vs. NCBI nr
Match: gi|566195099|ref|XP_002316920.2| (hypothetical protein POPTR_0011s12430g [Populus trichocarpa]) HSP 1 Score: 70.5 bits (171), Expect = 1.7e-09 Identity = 37/59 (62.71%), Postives = 46/59 (77.97%), Query Frame = 3
BLAST of CU124619 vs. NCBI nr
Match: gi|922392698|ref|XP_013464758.1| (hypothetical protein MTR_2g080030 [Medicago truncatula]) HSP 1 Score: 70.5 bits (171), Expect = 1.7e-09 Identity = 34/58 (58.62%), Postives = 44/58 (75.86%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|