CU124497 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGAAGCAACTCGGATCTCAAAAATTCAGCCACCCGCCAAGCTTTCTCATTCTCTCAATTGCGACTGTAGGACTTCAAGTTTCTTCAGTTCTTAATTTATTGATTTCTTGTTCTCAATTTCAAAACCATGGGTTTTCGTGTCGCAAAAATTGTAAATGCTGTGCATAATATAGGTCTTTCTTCTCTTGCAACAAACCAAGAACCATCAATTGTTCGCAAAAGGTTATTGTGCCGTTTATGTTGGAGAGAGCCAAAAG
BLAST of CU124497 vs. TrEMBL
Match: A0A0A0LM55_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G258630 PE=4 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 2.4e-07 Identity = 31/31 (100.00%), Postives = 31/31 (100.00%), Query Frame = 2
BLAST of CU124497 vs. TrEMBL
Match: A0A0A0LM55_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G258630 PE=4 SV=1) HSP 1 Score: 31.2 bits (69), Expect = 7.8e+02 Identity = 13/24 (54.17%), Postives = 16/24 (66.67%), Query Frame = 3
BLAST of CU124497 vs. NCBI nr
Match: gi|700206748|gb|KGN61867.1| (hypothetical protein Csa_2G258630 [Cucumis sativus]) HSP 1 Score: 63.2 bits (152), Expect = 2.7e-07 Identity = 31/31 (100.00%), Postives = 31/31 (100.00%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|