CU123653 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CAAGATAGTGCAAGAAGAATTGCTGAGATACAACATGAGTGCAAGTTGGATATAAATGTGGAAGAATATGTGGAATCAACAGTAAGGCCGCATTTGATGGATGTCATTTACTGTTGGTCAAAGGGAGCAAGTTTCTCAGAGGTGATTCAAATGACAGATATTTTCGAGGGTAGCATCATCCGAAGTGCTAGACGGCTTGATGAATTCTCGAATCAGTTGCG
BLAST of CU123653 vs. Swiss-Prot
Match: HEN2_ARATH (DExH-box ATP-dependent RNA helicase DExH10 OS=Arabidopsis thaliana GN=HEN2 PE=1 SV=2) HSP 1 Score: 132.5 bits (332), Expect = 1.9e-30 Identity = 64/73 (87.67%), Postives = 68/73 (93.15%), Query Frame = 1
BLAST of CU123653 vs. Swiss-Prot
Match: MTR4_ARATH (DExH-box ATP-dependent RNA helicase DExH9 OS=Arabidopsis thaliana GN=MTR4 PE=2 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 1.0e-15 Identity = 36/73 (49.32%), Postives = 57/73 (78.08%), Query Frame = 1
BLAST of CU123653 vs. Swiss-Prot
Match: SK2L2_HUMAN (Superkiller viralicidic activity 2-like 2 OS=Homo sapiens GN=SKIV2L2 PE=1 SV=3) HSP 1 Score: 83.2 bits (204), Expect = 1.3e-15 Identity = 38/73 (52.05%), Postives = 54/73 (73.97%), Query Frame = 1
BLAST of CU123653 vs. Swiss-Prot
Match: SK2L2_MOUSE (Superkiller viralicidic activity 2-like 2 OS=Mus musculus GN=Skiv2l2 PE=1 SV=1) HSP 1 Score: 83.2 bits (204), Expect = 1.3e-15 Identity = 38/73 (52.05%), Postives = 54/73 (73.97%), Query Frame = 1
BLAST of CU123653 vs. Swiss-Prot
Match: MTR4_SCHPO (ATP-dependent RNA helicase mtr4 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=mtr4 PE=1 SV=1) HSP 1 Score: 81.3 bits (199), Expect = 5.0e-15 Identity = 37/73 (50.68%), Postives = 53/73 (72.60%), Query Frame = 1
BLAST of CU123653 vs. TrEMBL
Match: A0A059CJH4_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_C00066 PE=4 SV=1) HSP 1 Score: 138.7 bits (348), Expect = 2.9e-30 Identity = 67/73 (91.78%), Postives = 71/73 (97.26%), Query Frame = 1
BLAST of CU123653 vs. TrEMBL
Match: W9RVH1_9ROSA (Superkiller viralicidic activity 2-like 2 OS=Morus notabilis GN=L484_008223 PE=4 SV=1) HSP 1 Score: 137.9 bits (346), Expect = 5.0e-30 Identity = 66/73 (90.41%), Postives = 72/73 (98.63%), Query Frame = 1
BLAST of CU123653 vs. TrEMBL
Match: F6H9P7_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_11s0065g00340 PE=4 SV=1) HSP 1 Score: 137.1 bits (344), Expect = 8.5e-30 Identity = 65/73 (89.04%), Postives = 71/73 (97.26%), Query Frame = 1
BLAST of CU123653 vs. TrEMBL
Match: A0A067LM94_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_17082 PE=4 SV=1) HSP 1 Score: 136.7 bits (343), Expect = 1.1e-29 Identity = 66/73 (90.41%), Postives = 72/73 (98.63%), Query Frame = 1
BLAST of CU123653 vs. TrEMBL
Match: A0A0B0P7U0_GOSAR (Superkiller viralicidic activity 2-like 2 OS=Gossypium arboreum GN=F383_08319 PE=4 SV=1) HSP 1 Score: 136.0 bits (341), Expect = 1.9e-29 Identity = 64/73 (87.67%), Postives = 71/73 (97.26%), Query Frame = 1
BLAST of CU123653 vs. NCBI nr
Match: gi|449470374|ref|XP_004152892.1| (PREDICTED: superkiller viralicidic activity 2-like 2 [Cucumis sativus]) HSP 1 Score: 146.7 bits (369), Expect = 1.5e-32 Identity = 72/73 (98.63%), Postives = 72/73 (98.63%), Query Frame = 1
BLAST of CU123653 vs. NCBI nr
Match: gi|659069579|ref|XP_008450745.1| (PREDICTED: superkiller viralicidic activity 2-like 2 [Cucumis melo]) HSP 1 Score: 144.4 bits (363), Expect = 7.6e-32 Identity = 71/73 (97.26%), Postives = 72/73 (98.63%), Query Frame = 1
BLAST of CU123653 vs. NCBI nr
Match: gi|702288787|ref|XP_010046886.1| (PREDICTED: superkiller viralicidic activity 2-like 2 isoform X1 [Eucalyptus grandis]) HSP 1 Score: 139.0 bits (349), Expect = 3.2e-30 Identity = 67/73 (91.78%), Postives = 71/73 (97.26%), Query Frame = 1
BLAST of CU123653 vs. NCBI nr
Match: gi|703139301|ref|XP_010106947.1| (Superkiller viralicidic activity 2-like 2 [Morus notabilis]) HSP 1 Score: 138.3 bits (347), Expect = 5.5e-30 Identity = 66/73 (90.41%), Postives = 72/73 (98.63%), Query Frame = 1
BLAST of CU123653 vs. NCBI nr
Match: gi|297736019|emb|CBI24057.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 137.5 bits (345), Expect = 9.3e-30 Identity = 65/73 (89.04%), Postives = 71/73 (97.26%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|