CU123622 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGGGATATAAATGTGGAAGAATATGTGGAATCAACAGTAAGGCCGCATTTGATGGATGTCATTTACTGTTGGTCAAAGGGAGCAAGTTTCTCAGAGGTGATTCAAAATGACAGACTATTTTCGAGGGTAGTCGATCATTCGAAGTGCTAGACGGCTTGATGA
BLAST of CU123622 vs. Swiss-Prot
Match: HEN2_ARATH (DExH-box ATP-dependent RNA helicase DExH10 OS=Arabidopsis thaliana GN=HEN2 PE=1 SV=2) HSP 1 Score: 62.4 bits (150), Expect = 1.8e-09 Identity = 28/39 (71.79%), Postives = 32/39 (82.05%), Query Frame = 1
BLAST of CU123622 vs. TrEMBL
Match: A0A059CJH4_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_C00066 PE=4 SV=1) HSP 1 Score: 71.2 bits (173), Expect = 4.2e-10 Identity = 32/39 (82.05%), Postives = 36/39 (92.31%), Query Frame = 1
BLAST of CU123622 vs. TrEMBL
Match: A0A067LM94_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_17082 PE=4 SV=1) HSP 1 Score: 70.5 bits (171), Expect = 7.2e-10 Identity = 32/39 (82.05%), Postives = 36/39 (92.31%), Query Frame = 1
BLAST of CU123622 vs. TrEMBL
Match: A0A0K9RHG7_SPIOL (Uncharacterized protein OS=Spinacia oleracea GN=SOVF_071150 PE=4 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 1.2e-09 Identity = 31/39 (79.49%), Postives = 35/39 (89.74%), Query Frame = 1
BLAST of CU123622 vs. TrEMBL
Match: U5FGE4_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0018s14280g PE=4 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 1.2e-09 Identity = 34/46 (73.91%), Postives = 37/46 (80.43%), Query Frame = 1
BLAST of CU123622 vs. TrEMBL
Match: A0A0J8CVK1_BETVU (Uncharacterized protein OS=Beta vulgaris subsp. vulgaris GN=BVRB_2g035760 PE=4 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 1.2e-09 Identity = 31/39 (79.49%), Postives = 35/39 (89.74%), Query Frame = 1
BLAST of CU123622 vs. NCBI nr
Match: gi|449470374|ref|XP_004152892.1| (PREDICTED: superkiller viralicidic activity 2-like 2 [Cucumis sativus]) HSP 1 Score: 78.2 bits (191), Expect = 5.0e-12 Identity = 35/39 (89.74%), Postives = 36/39 (92.31%), Query Frame = 1
BLAST of CU123622 vs. NCBI nr
Match: gi|659069579|ref|XP_008450745.1| (PREDICTED: superkiller viralicidic activity 2-like 2 [Cucumis melo]) HSP 1 Score: 75.9 bits (185), Expect = 2.5e-11 Identity = 34/39 (87.18%), Postives = 36/39 (92.31%), Query Frame = 1
BLAST of CU123622 vs. NCBI nr
Match: gi|702288787|ref|XP_010046886.1| (PREDICTED: superkiller viralicidic activity 2-like 2 isoform X1 [Eucalyptus grandis]) HSP 1 Score: 74.3 bits (181), Expect = 7.2e-11 Identity = 32/39 (82.05%), Postives = 36/39 (92.31%), Query Frame = 1
BLAST of CU123622 vs. NCBI nr
Match: gi|566215817|ref|XP_006372203.1| (hypothetical protein POPTR_0018s14280g [Populus trichocarpa]) HSP 1 Score: 73.6 bits (179), Expect = 1.2e-10 Identity = 34/46 (73.91%), Postives = 37/46 (80.43%), Query Frame = 1
BLAST of CU123622 vs. NCBI nr
Match: gi|802542055|ref|XP_012080959.1| (PREDICTED: superkiller viralicidic activity 2-like 2 [Jatropha curcas]) HSP 1 Score: 73.6 bits (179), Expect = 1.2e-10 Identity = 32/39 (82.05%), Postives = 36/39 (92.31%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|