CU123154 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGACATTTTAGAGATGGTTTTTCCTTTTTAAAAAACTAAGACCAAGGATGGATTCATGATCATCATGACAATTTCAAAATCACGCCTAATCATAGCCTCTTAGATTTACATACTAAGGTGGTTTTTCTTGTGTTCTGTAATCTACATTTCTTACAGCGCATAGAGAAGGTACTGGAAAGACAGTCCAGTCTTAAAATGGGGGCGAAAGTTGTGCATTATTTGTTGAACCATGGACTAATGTTACTGAAGTTCTCGT
BLAST of CU123154 vs. TrEMBL
Match: A0A0A0KVQ5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G095580 PE=4 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 7.5e-09 Identity = 34/35 (97.14%), Postives = 34/35 (97.14%), Query Frame = 2
BLAST of CU123154 vs. NCBI nr
Match: gi|778691787|ref|XP_011653351.1| (PREDICTED: uncharacterized protein LOC101221126 [Cucumis sativus]) HSP 1 Score: 67.0 bits (162), Expect = 1.8e-08 Identity = 34/35 (97.14%), Postives = 34/35 (97.14%), Query Frame = 2
BLAST of CU123154 vs. NCBI nr
Match: gi|700198490|gb|KGN53648.1| (hypothetical protein Csa_4G095580 [Cucumis sativus]) HSP 1 Score: 67.0 bits (162), Expect = 1.8e-08 Identity = 34/35 (97.14%), Postives = 34/35 (97.14%), Query Frame = 2
BLAST of CU123154 vs. NCBI nr
Match: gi|659111138|ref|XP_008455598.1| (PREDICTED: uncharacterized protein LOC103495734 isoform X1 [Cucumis melo]) HSP 1 Score: 62.8 bits (151), Expect = 3.5e-07 Identity = 31/35 (88.57%), Postives = 34/35 (97.14%), Query Frame = 2
BLAST of CU123154 vs. NCBI nr
Match: gi|659111140|ref|XP_008455600.1| (PREDICTED: uncharacterized protein LOC103495734 isoform X2 [Cucumis melo]) HSP 1 Score: 62.8 bits (151), Expect = 3.5e-07 Identity = 31/35 (88.57%), Postives = 34/35 (97.14%), Query Frame = 2
BLAST of CU123154 vs. NCBI nr
Match: gi|659111142|ref|XP_008455601.1| (PREDICTED: uncharacterized protein LOC103495734 isoform X3 [Cucumis melo]) HSP 1 Score: 62.8 bits (151), Expect = 3.5e-07 Identity = 31/35 (88.57%), Postives = 34/35 (97.14%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|