CU123141 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ATCTCTTCACTTGGACGGCAGAATGGACGATAACTCTTAATTAGGAAATCAAAGTATCCCCTTGCATCAGGATCTGATATAGGTGTATACCATGTATAGATGCACAACGCAACATTTAACCCTCAGTAGGATCGAATGAAAATCTAAAAGACCGCCATTGACAACAAAGGTAGGAGATGGCCGGCGATTTGGAGAGTGAGAGGGCAGTGGCTGAGAGAGGGCACGATGATGGCGG
BLAST of CU123141 vs. TrEMBL
Match: A0A0A0KVX9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G112620 PE=4 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 1.3e-07 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = -1
BLAST of CU123141 vs. TrEMBL
Match: A0A0A0KVX9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G112620 PE=4 SV=1) HSP 1 Score: 47.0 bits (110), Expect = 1.2e-02 Identity = 20/27 (74.07%), Postives = 23/27 (85.19%), Query Frame = -3
BLAST of CU123141 vs. NCBI nr
Match: gi|700198570|gb|KGN53728.1| (hypothetical protein Csa_4G112620 [Cucumis sativus]) HSP 1 Score: 60.1 bits (144), Expect = 2.0e-06 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|