CU121616 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTCCAGAAAATGTGGTAGTCTCCAAACCATCAGAAACTGACAGACTTTCAGTTTTCTCTGCTAACTTGTCAACAATCTCATCAGTCCGATCCTGAAGTACAACCTTCTTCTTCTTCTTCTTCTTAGTTGGATCGAAGGCAATCTGCAAGAATAAACCATATAAATGCATCATGCTGTCGCATCTATGCTTGCACATGAACAACAATTCGTAACTGCTTGATAAAGAGACATAGTAAGATATGGGCCTGTAACTCGACAGCAGAATGCAGCTTCGATCCTTAGCCCCCGGCCG
BLAST of CU121616 vs. NCBI nr
Match: gi|700208831|gb|KGN63927.1| (hypothetical protein Csa_1G028050 [Cucumis sativus]) HSP 1 Score: 75.5 bits (184), Expect = 5.8e-11 Identity = 40/47 (85.11%), Postives = 40/47 (85.11%), Query Frame = -1
BLAST of CU121616 vs. NCBI nr
Match: gi|778656633|ref|XP_011649426.1| (PREDICTED: eukaryotic translation initiation factor 2 subunit beta-like [Cucumis sativus]) HSP 1 Score: 75.5 bits (184), Expect = 5.8e-11 Identity = 40/47 (85.11%), Postives = 40/47 (85.11%), Query Frame = -1
BLAST of CU121616 vs. NCBI nr
Match: gi|659071819|ref|XP_008462075.1| (PREDICTED: eukaryotic translation initiation factor 2 subunit beta [Cucumis melo]) HSP 1 Score: 69.3 bits (168), Expect = 4.1e-09 Identity = 37/45 (82.22%), Postives = 37/45 (82.22%), Query Frame = -1
BLAST of CU121616 vs. NCBI nr
Match: gi|778659350|ref|XP_004139463.2| (PREDICTED: eukaryotic translation initiation factor 2 subunit beta [Cucumis sativus]) HSP 1 Score: 63.2 bits (152), Expect = 3.0e-07 Identity = 34/45 (75.56%), Postives = 34/45 (75.56%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|