CU121498 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGTAATACTAAAATTTTGTTATATTTTTAGGAATTTGTATGTATGTAATATATCAATAATATGGTTCTTTGAAAAGCAAGACATAAACAATGCAAGCTATAGCAAAGAGAATGATAAAGATATCTAAAGTAAGAGCAGTGGAGGCTTGATCACTCAACTCCAAGTTTCTTCCTCCAAGCCTATCCACCATGTCTGGAGTT
BLAST of CU121498 vs. Swiss-Prot
Match: NDHT_ARATH (NAD(P)H-quinone oxidoreductase subunit T, chloroplastic OS=Arabidopsis thaliana GN=ndhT PE=1 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 2.5e-13 Identity = 33/45 (73.33%), Postives = 38/45 (84.44%), Query Frame = -2
BLAST of CU121498 vs. TrEMBL
Match: A0A0A0LT25_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G042670 PE=4 SV=1) HSP 1 Score: 92.4 bits (228), Expect = 2.2e-16 Identity = 46/46 (100.00%), Postives = 46/46 (100.00%), Query Frame = -2
BLAST of CU121498 vs. TrEMBL
Match: B9T8B6_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_0176710 PE=4 SV=1) HSP 1 Score: 82.0 bits (201), Expect = 2.9e-13 Identity = 38/45 (84.44%), Postives = 42/45 (93.33%), Query Frame = -2
BLAST of CU121498 vs. TrEMBL
Match: A0A061EBG7_THECC (Chaperone DnaJ-domain superfamily protein OS=Theobroma cacao GN=TCM_011554 PE=4 SV=1) HSP 1 Score: 81.6 bits (200), Expect = 3.8e-13 Identity = 36/45 (80.00%), Postives = 42/45 (93.33%), Query Frame = -2
BLAST of CU121498 vs. TrEMBL
Match: A0A0F7H024_9ROSI (Chaperone DnaJ-domain superfamily protein (Fragment) OS=Melianthus villosus GN=NDHT PE=2 SV=1) HSP 1 Score: 79.7 bits (195), Expect = 1.5e-12 Identity = 37/45 (82.22%), Postives = 43/45 (95.56%), Query Frame = -2
BLAST of CU121498 vs. TrEMBL
Match: A5CA95_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_18s0117g00260 PE=4 SV=1) HSP 1 Score: 79.7 bits (195), Expect = 1.5e-12 Identity = 37/45 (82.22%), Postives = 41/45 (91.11%), Query Frame = -2
BLAST of CU121498 vs. NCBI nr
Match: gi|449439697|ref|XP_004137622.1| (PREDICTED: NAD(P)H-quinone oxidoreductase subunit T, chloroplastic isoform X1 [Cucumis sativus]) HSP 1 Score: 90.1 bits (222), Expect = 1.5e-15 Identity = 46/46 (100.00%), Postives = 46/46 (100.00%), Query Frame = -2
BLAST of CU121498 vs. NCBI nr
Match: gi|778657329|ref|XP_011650709.1| (PREDICTED: NAD(P)H-quinone oxidoreductase subunit T, chloroplastic isoform X2 [Cucumis sativus]) HSP 1 Score: 90.1 bits (222), Expect = 1.5e-15 Identity = 46/46 (100.00%), Postives = 46/46 (100.00%), Query Frame = -2
BLAST of CU121498 vs. NCBI nr
Match: gi|659066817|ref|XP_008462782.1| (PREDICTED: dnaJ homolog subfamily B member 12 [Cucumis melo]) HSP 1 Score: 87.4 bits (215), Expect = 1.0e-14 Identity = 43/46 (93.48%), Postives = 46/46 (100.00%), Query Frame = -2
BLAST of CU121498 vs. NCBI nr
Match: gi|223525214|gb|EEF27898.1| (conserved hypothetical protein [Ricinus communis]) HSP 1 Score: 79.7 bits (195), Expect = 2.1e-12 Identity = 38/45 (84.44%), Postives = 42/45 (93.33%), Query Frame = -2
BLAST of CU121498 vs. NCBI nr
Match: gi|590699286|ref|XP_007045885.1| (Chaperone DnaJ-domain superfamily protein [Theobroma cacao]) HSP 1 Score: 79.3 bits (194), Expect = 2.7e-12 Identity = 36/45 (80.00%), Postives = 42/45 (93.33%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|