CU121413 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CCTCCGTATCCACCACCACCTCCTCCGTATCCACCACCACCTCCGCCTCCGTATCCTCCACAATTTCACCACAGGAGCTGGAAGAGATGTGGTTCATTTGAATGTCACCAGGCCTTATTACTTCATAAGTGGAAGAGGCTTTTGCTTTGGGGGCATGAAGCTTGCTATCCATGTCGAACACCTACCT
BLAST of CU121413 vs. Swiss-Prot
Match: LAML_ARATH (Lamin-like protein OS=Arabidopsis thaliana GN=At5g15350 PE=1 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 1.3e-08 Identity = 25/42 (59.52%), Postives = 31/42 (73.81%), Query Frame = 2
BLAST of CU121413 vs. TrEMBL
Match: A0A0A0LC11_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G824220 PE=4 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 1.6e-16 Identity = 41/42 (97.62%), Postives = 42/42 (100.00%), Query Frame = 2
BLAST of CU121413 vs. TrEMBL
Match: Q2HW94_MEDTR (Blue (Type 1) copper domain OS=Medicago truncatula GN=MTR_6g013420 PE=2 SV=1) HSP 1 Score: 80.5 bits (197), Expect = 8.0e-13 Identity = 36/42 (85.71%), Postives = 40/42 (95.24%), Query Frame = 2
BLAST of CU121413 vs. TrEMBL
Match: A0A067JTG9_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_19891 PE=4 SV=1) HSP 1 Score: 77.8 bits (190), Expect = 5.2e-12 Identity = 35/42 (83.33%), Postives = 39/42 (92.86%), Query Frame = 2
BLAST of CU121413 vs. TrEMBL
Match: B9T3T7_RICCO (Blue copper protein, putative OS=Ricinus communis GN=RCOM_0169200 PE=4 SV=1) HSP 1 Score: 77.0 bits (188), Expect = 8.8e-12 Identity = 35/42 (83.33%), Postives = 39/42 (92.86%), Query Frame = 2
BLAST of CU121413 vs. TrEMBL
Match: A0A022RWL9_ERYGU (Uncharacterized protein OS=Erythranthe guttata GN=MIMGU_mgv1a014978mg PE=4 SV=1) HSP 1 Score: 76.6 bits (187), Expect = 1.2e-11 Identity = 35/42 (83.33%), Postives = 39/42 (92.86%), Query Frame = 2
BLAST of CU121413 vs. NCBI nr
Match: gi|449437808|ref|XP_004136682.1| (PREDICTED: lamin-like protein [Cucumis sativus]) HSP 1 Score: 95.1 bits (235), Expect = 4.5e-17 Identity = 41/42 (97.62%), Postives = 42/42 (100.00%), Query Frame = 2
BLAST of CU121413 vs. NCBI nr
Match: gi|659085323|ref|XP_008443359.1| (PREDICTED: lamin-like protein [Cucumis melo]) HSP 1 Score: 94.0 bits (232), Expect = 1.0e-16 Identity = 40/42 (95.24%), Postives = 42/42 (100.00%), Query Frame = 2
BLAST of CU121413 vs. NCBI nr
Match: gi|357496611|ref|XP_003618594.1| (blue copper-like protein [Medicago truncatula]) HSP 1 Score: 82.8 bits (203), Expect = 2.3e-13 Identity = 36/42 (85.71%), Postives = 40/42 (95.24%), Query Frame = 2
BLAST of CU121413 vs. NCBI nr
Match: gi|1012261357|ref|XP_015946173.1| (PREDICTED: lamin-like protein [Arachis duranensis]) HSP 1 Score: 82.8 bits (203), Expect = 2.3e-13 Identity = 36/42 (85.71%), Postives = 40/42 (95.24%), Query Frame = 2
BLAST of CU121413 vs. NCBI nr
Match: gi|502091076|ref|XP_004489434.1| (PREDICTED: lamin-like protein [Cicer arietinum]) HSP 1 Score: 82.0 bits (201), Expect = 3.9e-13 Identity = 36/42 (85.71%), Postives = 40/42 (95.24%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|