CU121043 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTAGCAACCAAACAGAACAAAAAAACTTCAAGCTAAAGGTTTAAAACCCCGGCAAAATCCAACAAGACCCCAAAAACAAACTAAAGAGGCTGAAAATCCACATAAGATCTGAAAATCAGCAATAACTCTAAACACCATTCACAGATCTATAGATAGAGGTGCTTACAGAGCCAATCATCATAATAGAAGTGCTTTCCCTGAGCCCAGGTAGTATAGTTCACATTAGTATTCCAACCCATGTTGCCACCGACAGTCCCCCGGCCG
BLAST of CU121043 vs. Swiss-Prot
Match: LAML_ARATH (Lamin-like protein OS=Arabidopsis thaliana GN=At5g15350 PE=1 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 1.0e-06 Identity = 21/29 (72.41%), Postives = 20/29 (68.97%), Query Frame = -2
BLAST of CU121043 vs. TrEMBL
Match: A0A0A0LC11_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G824220 PE=4 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 6.2e-11 Identity = 30/31 (96.77%), Postives = 30/31 (96.77%), Query Frame = -2
BLAST of CU121043 vs. TrEMBL
Match: W9QQU4_9ROSA (Lamin-like protein OS=Morus notabilis GN=L484_020958 PE=4 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 8.3e-08 Identity = 26/31 (83.87%), Postives = 26/31 (83.87%), Query Frame = -2
BLAST of CU121043 vs. TrEMBL
Match: Q2HW94_MEDTR (Blue (Type 1) copper domain OS=Medicago truncatula GN=MTR_6g013420 PE=2 SV=1) HSP 1 Score: 60.1 bits (144), Expect = 1.6e-06 Identity = 24/31 (77.42%), Postives = 25/31 (80.65%), Query Frame = -2
BLAST of CU121043 vs. TrEMBL
Match: A9PAA9_POPTR (Plastocyanin-like domain-containing family protein OS=Populus trichocarpa GN=POPTR_0017s12460g PE=2 SV=1) HSP 1 Score: 60.1 bits (144), Expect = 1.6e-06 Identity = 24/31 (77.42%), Postives = 25/31 (80.65%), Query Frame = -2
BLAST of CU121043 vs. TrEMBL
Match: B9T3T7_RICCO (Blue copper protein, putative OS=Ricinus communis GN=RCOM_0169200 PE=4 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 2.1e-06 Identity = 24/31 (77.42%), Postives = 25/31 (80.65%), Query Frame = -2
BLAST of CU121043 vs. NCBI nr
Match: gi|449437808|ref|XP_004136682.1| (PREDICTED: lamin-like protein [Cucumis sativus]) HSP 1 Score: 72.0 bits (175), Expect = 5.7e-10 Identity = 30/31 (96.77%), Postives = 30/31 (96.77%), Query Frame = -2
BLAST of CU121043 vs. NCBI nr
Match: gi|659085323|ref|XP_008443359.1| (PREDICTED: lamin-like protein [Cucumis melo]) HSP 1 Score: 68.2 bits (165), Expect = 8.3e-09 Identity = 28/31 (90.32%), Postives = 29/31 (93.55%), Query Frame = -2
BLAST of CU121043 vs. NCBI nr
Match: gi|703073526|ref|XP_010089568.1| (Lamin-like protein [Morus notabilis]) HSP 1 Score: 61.6 bits (148), Expect = 7.7e-07 Identity = 26/31 (83.87%), Postives = 26/31 (83.87%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|