CU120809 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGAACCCAAATCTCTCACATATTCTCTTTTAAGTACAAGCACATTTTATCTCAATCAAATTCAGAGATGGGAATCCGTTTTCCTTCGGTCCTCCTCAGTGCCAAGCAGATTCTCAAGATGAAATCTGTTTCTATAAGATGTCAGTCTGATGTTCCCAAAGGCCACATTCCGGTGTATGTTGGAGAAAACCAGAGAAAGCGGTTTTTTGTTCCGATTTCTTACTTGAATCATCCTTCATTTGTGAATTT
BLAST of CU120809 vs. Swiss-Prot
Match: SAU20_ARATH (Auxin-responsive protein SAUR20 OS=Arabidopsis thaliana GN=SAUR20 PE=2 SV=1) HSP 1 Score: 56.6 bits (135), Expect = 1.5e-07 Identity = 31/54 (57.41%), Postives = 34/54 (62.96%), Query Frame = 2
BLAST of CU120809 vs. Swiss-Prot
Match: SAU22_ARATH (Auxin-responsive protein SAUR22 OS=Arabidopsis thaliana GN=SAUR22 PE=2 SV=1) HSP 1 Score: 56.2 bits (134), Expect = 2.0e-07 Identity = 27/50 (54.00%), Postives = 34/50 (68.00%), Query Frame = 2
BLAST of CU120809 vs. Swiss-Prot
Match: SAU24_ARATH (Auxin-responsive protein SAUR24 OS=Arabidopsis thaliana GN=SAUR24 PE=2 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 3.4e-07 Identity = 30/54 (55.56%), Postives = 34/54 (62.96%), Query Frame = 2
BLAST of CU120809 vs. Swiss-Prot
Match: SAU23_ARATH (Auxin-responsive protein SAUR23 OS=Arabidopsis thaliana GN=SAUR23 PE=2 SV=1) HSP 1 Score: 54.7 bits (130), Expect = 5.7e-07 Identity = 27/50 (54.00%), Postives = 34/50 (68.00%), Query Frame = 2
BLAST of CU120809 vs. Swiss-Prot
Match: SAU19_ARATH (Auxin-responsive protein SAUR19 OS=Arabidopsis thaliana GN=SAUR19 PE=2 SV=1) HSP 1 Score: 53.5 bits (127), Expect = 1.3e-06 Identity = 29/54 (53.70%), Postives = 34/54 (62.96%), Query Frame = 2
BLAST of CU120809 vs. TrEMBL
Match: A0A0A0LLF7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G258750 PE=4 SV=1) HSP 1 Score: 124.4 bits (311), Expect = 6.5e-26 Identity = 60/60 (100.00%), Postives = 60/60 (100.00%), Query Frame = 2
BLAST of CU120809 vs. TrEMBL
Match: A0A0A0LM65_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G258730 PE=4 SV=1) HSP 1 Score: 116.7 bits (291), Expect = 1.4e-23 Identity = 56/60 (93.33%), Postives = 57/60 (95.00%), Query Frame = 2
BLAST of CU120809 vs. TrEMBL
Match: A0A0A0LJ92_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G258690 PE=4 SV=1) HSP 1 Score: 99.4 bits (246), Expect = 2.3e-18 Identity = 48/59 (81.36%), Postives = 52/59 (88.14%), Query Frame = 2
BLAST of CU120809 vs. TrEMBL
Match: A0A0A0LIZ4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G258710 PE=4 SV=1) HSP 1 Score: 95.9 bits (237), Expect = 2.5e-17 Identity = 45/60 (75.00%), Postives = 51/60 (85.00%), Query Frame = 2
BLAST of CU120809 vs. TrEMBL
Match: A0A0A0LPH3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G258670 PE=4 SV=1) HSP 1 Score: 94.4 bits (233), Expect = 7.3e-17 Identity = 42/60 (70.00%), Postives = 53/60 (88.33%), Query Frame = 2
BLAST of CU120809 vs. NCBI nr
Match: gi|778669595|ref|XP_011649275.1| (PREDICTED: auxin-induced protein 15A-like [Cucumis sativus]) HSP 1 Score: 125.2 bits (313), Expect = 5.5e-26 Identity = 60/60 (100.00%), Postives = 60/60 (100.00%), Query Frame = 2
BLAST of CU120809 vs. NCBI nr
Match: gi|778669591|ref|XP_011649272.1| (PREDICTED: auxin-induced protein 15A-like [Cucumis sativus]) HSP 1 Score: 117.5 bits (293), Expect = 1.1e-23 Identity = 56/60 (93.33%), Postives = 57/60 (95.00%), Query Frame = 2
BLAST of CU120809 vs. NCBI nr
Match: gi|659115594|ref|XP_008457634.1| (PREDICTED: auxin-induced protein 15A-like [Cucumis melo]) HSP 1 Score: 115.5 bits (288), Expect = 4.4e-23 Identity = 55/60 (91.67%), Postives = 57/60 (95.00%), Query Frame = 2
BLAST of CU120809 vs. NCBI nr
Match: gi|778669586|ref|XP_011649271.1| (PREDICTED: auxin-induced protein X10A-like [Cucumis sativus]) HSP 1 Score: 100.1 bits (248), Expect = 1.9e-18 Identity = 48/59 (81.36%), Postives = 52/59 (88.14%), Query Frame = 2
BLAST of CU120809 vs. NCBI nr
Match: gi|778669614|ref|XP_011649278.1| (PREDICTED: auxin-induced protein 15A-like [Cucumis sativus]) HSP 1 Score: 97.1 bits (240), Expect = 1.6e-17 Identity = 46/60 (76.67%), Postives = 53/60 (88.33%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|