CU119857 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GAAGGCTTGGGGATTGGAAGTAATATAATCGGTACCGTTCATCAACAGAATATGTGGGTGGAGTATGATTTGGCCAATAAGAGAGTAGGGTTTGGTGGAGCTGAGTGTAGCAGATTGAAGTGATGATGGACAGTAAAGATTTATACACGTGTGTGGGTTTTGAATGTTTATATAATCATATTTGATATTGTGTTATTGTGTAAATGTGTGTATAGTTATTTCATTTCACATATATACTTTATATATAAAATAAAAACAAAAAAATTTTCTATAACCT
BLAST of CU119857 vs. TrEMBL
Match: A0A0A0L6V5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G188350 PE=3 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 1.1e-13 Identity = 39/40 (97.50%), Postives = 39/40 (97.50%), Query Frame = 1
BLAST of CU119857 vs. TrEMBL
Match: A0A0A0LBQ0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G188340 PE=3 SV=1) HSP 1 Score: 82.8 bits (203), Expect = 2.4e-13 Identity = 38/38 (100.00%), Postives = 38/38 (100.00%), Query Frame = 1
BLAST of CU119857 vs. TrEMBL
Match: G7KG25_MEDTR (Eukaryotic aspartyl protease family protein OS=Medicago truncatula GN=MTR_5g077850 PE=3 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 4.0e-08 Identity = 28/39 (71.79%), Postives = 33/39 (84.62%), Query Frame = 1
BLAST of CU119857 vs. TrEMBL
Match: A0A0L9U8R6_PHAAN (Uncharacterized protein OS=Phaseolus angularis GN=LR48_Vigan03g261700 PE=3 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 4.0e-08 Identity = 28/37 (75.68%), Postives = 32/37 (86.49%), Query Frame = 1
BLAST of CU119857 vs. TrEMBL
Match: I1MBU0_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_14G212700 PE=3 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 5.2e-08 Identity = 28/39 (71.79%), Postives = 33/39 (84.62%), Query Frame = 1
BLAST of CU119857 vs. NCBI nr
Match: gi|778679913|ref|XP_004140731.2| (PREDICTED: aspartic proteinase PCS1-like [Cucumis sativus]) HSP 1 Score: 87.4 bits (215), Expect = 1.4e-14 Identity = 39/40 (97.50%), Postives = 39/40 (97.50%), Query Frame = 1
BLAST of CU119857 vs. NCBI nr
Match: gi|700202330|gb|KGN57463.1| (hypothetical protein Csa_3G188350 [Cucumis sativus]) HSP 1 Score: 87.4 bits (215), Expect = 1.4e-14 Identity = 39/40 (97.50%), Postives = 39/40 (97.50%), Query Frame = 1
BLAST of CU119857 vs. NCBI nr
Match: gi|778679910|ref|XP_011651212.1| (PREDICTED: aspartic proteinase PCS1-like [Cucumis sativus]) HSP 1 Score: 86.3 bits (212), Expect = 3.1e-14 Identity = 38/38 (100.00%), Postives = 38/38 (100.00%), Query Frame = 1
BLAST of CU119857 vs. NCBI nr
Match: gi|700202328|gb|KGN57461.1| (hypothetical protein Csa_3G188340 [Cucumis sativus]) HSP 1 Score: 86.3 bits (212), Expect = 3.1e-14 Identity = 38/38 (100.00%), Postives = 38/38 (100.00%), Query Frame = 1
BLAST of CU119857 vs. NCBI nr
Match: gi|659114575|ref|XP_008457122.1| (PREDICTED: aspartic proteinase PCS1 [Cucumis melo]) HSP 1 Score: 84.3 bits (207), Expect = 1.2e-13 Identity = 36/40 (90.00%), Postives = 38/40 (95.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|