CU119821 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TAAAAAAGGAACTTCCTCTTGTTTTCAAGCAGGTCTTTCTCTAAAACTCTTTCTCCCCTCATACTTTCATCATGGAAATGAAGAACTTTGCCTGCGCCGCTTTCATCACTGTTGCCGCCTCCCTGAGCATGGTTTTGGCCTCTGATGAAGCAGCGTCCCCAGCACCCGGCCCATCTAGCGCTGCTTCCGCTACTTTGCCAGTCGTCGGGACGTTGCTAGGTGCATCTGCTGCCTCTCTCATTGCTTACTGCCTTCAGTAACTGAGTTTAGCAGTGTTGAGGAAGGGGGAAATAAATCAATGTGGGTTTATTTTTTTCATTTTCCATC
BLAST of CU119821 vs. TrEMBL
Match: A0A0A0L2P9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G572270 PE=4 SV=1) HSP 1 Score: 75.9 bits (185), Expect = 3.4e-11 Identity = 42/60 (70.00%), Postives = 42/60 (70.00%), Query Frame = -3
BLAST of CU119821 vs. NCBI nr
Match: gi|700199724|gb|KGN54882.1| (hypothetical protein Csa_4G572270 [Cucumis sativus]) HSP 1 Score: 76.6 bits (187), Expect = 2.9e-11 Identity = 42/60 (70.00%), Postives = 42/60 (70.00%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|