CU119260 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTTTATATAAAATCGTTCCTCACCAGTCAGATCGTGTGGTTTCACCATAGGACCCTGAACTTTAGGAACTTCATACCGCCTTAACCTCTCAATCAGCAATGCTTCCTTAATCCTGGCGTTTTCCAGCTTGTTCTTGATTCTCTCTGCTGCATTTGGAAATTTCTGTTTCTTCTTCCCCTTGACACGCAGTTGACGAGGGTCTCTCTTATTTGCTGCTTTTCTTTTCTGCCTTAATCTCATTCGCTGCATCTTCT
BLAST of CU119260 vs. TrEMBL
Match: A0A067LI04_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_20864 PE=4 SV=1) HSP 1 Score: 118.2 bits (295), Expect = 4.7e-24 Identity = 58/71 (81.69%), Postives = 63/71 (88.73%), Query Frame = -3
BLAST of CU119260 vs. TrEMBL
Match: V4T7K8_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10020228mg PE=4 SV=1) HSP 1 Score: 117.9 bits (294), Expect = 6.1e-24 Identity = 59/72 (81.94%), Postives = 65/72 (90.28%), Query Frame = -3
BLAST of CU119260 vs. TrEMBL
Match: A0A068V4M1_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00043233001 PE=4 SV=1) HSP 1 Score: 115.9 bits (289), Expect = 2.3e-23 Identity = 59/73 (80.82%), Postives = 66/73 (90.41%), Query Frame = -3
BLAST of CU119260 vs. TrEMBL
Match: A0A068UUV5_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00035780001 PE=4 SV=1) HSP 1 Score: 115.9 bits (289), Expect = 2.3e-23 Identity = 59/73 (80.82%), Postives = 66/73 (90.41%), Query Frame = -3
BLAST of CU119260 vs. TrEMBL
Match: K4CQ17_SOLLC (Uncharacterized protein OS=Solanum lycopersicum PE=4 SV=1) HSP 1 Score: 114.0 bits (284), Expect = 8.8e-23 Identity = 58/73 (79.45%), Postives = 64/73 (87.67%), Query Frame = -3
BLAST of CU119260 vs. NCBI nr
Match: gi|449437795|ref|XP_004136676.1| (PREDICTED: uncharacterized CRM domain-containing protein At3g25440, chloroplastic [Cucumis sativus]) HSP 1 Score: 142.5 bits (358), Expect = 3.3e-31 Identity = 72/72 (100.00%), Postives = 72/72 (100.00%), Query Frame = -3
BLAST of CU119260 vs. NCBI nr
Match: gi|659085302|ref|XP_008443348.1| (PREDICTED: uncharacterized protein LOC103486957 [Cucumis melo]) HSP 1 Score: 131.7 bits (330), Expect = 5.9e-28 Identity = 66/72 (91.67%), Postives = 70/72 (97.22%), Query Frame = -3
BLAST of CU119260 vs. NCBI nr
Match: gi|643737829|gb|KDP43854.1| (hypothetical protein JCGZ_20864 [Jatropha curcas]) HSP 1 Score: 114.4 bits (285), Expect = 9.7e-23 Identity = 58/71 (81.69%), Postives = 63/71 (88.73%), Query Frame = -3
BLAST of CU119260 vs. NCBI nr
Match: gi|802554972|ref|XP_012065185.1| (PREDICTED: uncharacterized CRM domain-containing protein At3g25440, chloroplastic [Jatropha curcas]) HSP 1 Score: 114.4 bits (285), Expect = 9.7e-23 Identity = 58/71 (81.69%), Postives = 63/71 (88.73%), Query Frame = -3
BLAST of CU119260 vs. NCBI nr
Match: gi|567901040|ref|XP_006443008.1| (hypothetical protein CICLE_v10020228mg [Citrus clementina]) HSP 1 Score: 114.0 bits (284), Expect = 1.3e-22 Identity = 59/72 (81.94%), Postives = 65/72 (90.28%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|