CU119239 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ATACATTTAAAAGACAAAAAGAAAATGGTTTTGGCATTACCGGGAGATAAATTGTGTCGTTGGCCATTTGTGTAGAAGGAAAAGGAGGTTGTAAACCTGCGAAATAATAATACTAGTTCAAACACGAAACAGAAAACAGGAGAGGAATTAAAATATGCAAAATAAACATTATGCAACATTCAAATCTTAGTTGCTAGCAGGATAACTTGCCTGATTCATTGGTCAGAGCTCTCAGGTATTTGCAAGTACTTGTTGTATAGCCAGTGGGATGTGTCAAGTGCATCTCCATTGCTTTCCACAGGGTAATCTTTCTGCTGCTTTG
BLAST of CU119239 vs. TrEMBL
Match: A0A0A0LNZ3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G005760 PE=4 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 7.6e-11 Identity = 32/38 (84.21%), Postives = 36/38 (94.74%), Query Frame = -1
BLAST of CU119239 vs. TrEMBL
Match: A0A0A0LNZ3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G005760 PE=4 SV=1) HSP 1 Score: 45.1 bits (105), Expect = 6.4e-02 Identity = 19/20 (95.00%), Postives = 20/20 (100.00%), Query Frame = -1
BLAST of CU119239 vs. NCBI nr
Match: gi|700208519|gb|KGN63615.1| (hypothetical protein Csa_1G005760 [Cucumis sativus]) HSP 1 Score: 75.1 bits (183), Expect = 8.3e-11 Identity = 32/38 (84.21%), Postives = 36/38 (94.74%), Query Frame = -1
BLAST of CU119239 vs. NCBI nr
Match: gi|778655772|ref|XP_011658935.1| (PREDICTED: alpha-N-acetylglucosaminidase-like [Cucumis sativus]) HSP 1 Score: 68.6 bits (166), Expect = 7.7e-09 Identity = 30/32 (93.75%), Postives = 31/32 (96.88%), Query Frame = -3
BLAST of CU119239 vs. NCBI nr
Match: gi|659105587|ref|XP_008453133.1| (PREDICTED: alpha-N-acetylglucosaminidase-like [Cucumis melo]) HSP 1 Score: 65.9 bits (159), Expect = 5.0e-08 Identity = 29/32 (90.62%), Postives = 30/32 (93.75%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|