CU119150 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGGGGATTGCGAATTCCTCGAAATCAAACTGTTTAGCGGCTTTGGGGTGGAACGCCGGAGAAGACGAAAATGACCGCCGGCTTGTCTTTCACGGTCACAGCTGCTCCGAAACCATTCTTTCAGCTTCAGACTACTCATCACAGCAGTATCAGTTCAACCGAGACGCGTATGCGAATTCGAAGCATTCAATCCAAATTGGCTTACAGTTCTACGCCACT
BLAST of CU119150 vs. TrEMBL
Match: A0A0A0LQB8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G032430 PE=4 SV=1) HSP 1 Score: 70.1 bits (170), Expect = 1.3e-09 Identity = 37/49 (75.51%), Postives = 37/49 (75.51%), Query Frame = 1
BLAST of CU119150 vs. NCBI nr
Match: gi|778656777|ref|XP_011649654.1| (PREDICTED: glycine-rich RNA-binding protein 4, mitochondrial-like isoform X2 [Cucumis sativus]) HSP 1 Score: 70.1 bits (170), Expect = 1.8e-09 Identity = 37/49 (75.51%), Postives = 37/49 (75.51%), Query Frame = 1
BLAST of CU119150 vs. NCBI nr
Match: gi|778656774|ref|XP_011649648.1| (PREDICTED: glycine-rich RNA-binding protein 4, mitochondrial-like isoform X1 [Cucumis sativus]) HSP 1 Score: 70.1 bits (170), Expect = 1.8e-09 Identity = 37/49 (75.51%), Postives = 37/49 (75.51%), Query Frame = 1
BLAST of CU119150 vs. NCBI nr
Match: gi|659066336|ref|XP_008439477.1| (PREDICTED: glycine-rich RNA-binding protein 4, mitochondrial-like [Cucumis melo]) HSP 1 Score: 60.8 bits (146), Expect = 1.1e-06 Identity = 32/49 (65.31%), Postives = 33/49 (67.35%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|