CU118486 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGGGAGGTAAACTTAGAGAGCAAGTTTTCTGCAGCCAGTGAAAGCCTTCGCAGAGGTATAATGTTCGCAAACTCACTCTATTTGTAGATTGTCCCCTGCTTTGGTTGCATCTTCAGGGGTTCATGAAGCTCTGAGATTGTGGTTTTCACCAACCATTTTTCATAGAGGTATTTTCTCTATTTTCCATGTTTAAGATGTACTGGAATACAAATTTTTGGATATTTTAGCATAAACTAGAAA
BLAST of CU118486 vs. Swiss-Prot
Match: HEN2_ARATH (DExH-box ATP-dependent RNA helicase DExH10 OS=Arabidopsis thaliana GN=HEN2 PE=1 SV=2) HSP 1 Score: 50.8 bits (120), Expect = 7.9e-06 Identity = 25/28 (89.29%), Postives = 25/28 (89.29%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|