CU118005 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTTCCATCGACATGTACAAAGAACGAGCCGTTCAAATTTCCACTGTCAACACCATCAACTCCTCTCTCAAGGAGCTCTTTTCTCACTCCTTTAACGTAACATTCAAACCCTTCTCTCCCCCTTCCCTCAAAGATCTTACTGAAACGATAAATTTGCTTCTTCAATGTCTCGATTACTCCCC
BLAST of CU118005 vs. TrEMBL
Match: A0A0A0L740_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G213500 PE=4 SV=1) HSP 1 Score: 117.9 bits (294), Expect = 4.3e-24 Identity = 58/58 (100.00%), Postives = 58/58 (100.00%), Query Frame = 3
BLAST of CU118005 vs. NCBI nr
Match: gi|700202425|gb|KGN57558.1| (hypothetical protein Csa_3G213500 [Cucumis sativus]) HSP 1 Score: 116.7 bits (291), Expect = 1.4e-23 Identity = 58/58 (100.00%), Postives = 58/58 (100.00%), Query Frame = 3
BLAST of CU118005 vs. NCBI nr
Match: gi|659077518|ref|XP_008439248.1| (PREDICTED: kinetochore protein NDC80 homolog [Cucumis melo]) HSP 1 Score: 116.7 bits (291), Expect = 1.4e-23 Identity = 58/58 (100.00%), Postives = 58/58 (100.00%), Query Frame = 3
BLAST of CU118005 vs. NCBI nr
Match: gi|778680142|ref|XP_004149971.2| (PREDICTED: kinetochore protein NDC80 homolog [Cucumis sativus]) HSP 1 Score: 116.7 bits (291), Expect = 1.4e-23 Identity = 58/58 (100.00%), Postives = 58/58 (100.00%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|