CU117917 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGAAAGATCACCTCTTTACTAGATGCAATATAGACAAGTCAATACAAATAAACCAAGTCAGATTTCATGTATATCATTGAATGAGAAAAGTTAATATGCATTACATGGAAATAATGATCACCACAAAAACAGCCAGCAAAGAAATGAGAAATTTACCACAAGGTCTGACAATTCCACCCTTAGAAAACACCTTATCTTTGCAATCAAGAACATGGCATATGCATCTCAAACCCACTCCA
BLAST of CU117917 vs. TrEMBL
Match: B9HQU1_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0009s15040g PE=4 SV=2) HSP 1 Score: 57.4 bits (137), Expect = 9.2e-06 Identity = 24/47 (51.06%), Postives = 32/47 (68.09%), Query Frame = -2
BLAST of CU117917 vs. NCBI nr
Match: gi|449443410|ref|XP_004139470.1| (PREDICTED: uncharacterized protein LOC101222629 isoform X1 [Cucumis sativus]) HSP 1 Score: 93.6 bits (231), Expect = 1.7e-16 Identity = 45/45 (100.00%), Postives = 45/45 (100.00%), Query Frame = -2
BLAST of CU117917 vs. NCBI nr
Match: gi|659071772|ref|XP_008461870.1| (PREDICTED: uncharacterized protein LOC103500362 [Cucumis melo]) HSP 1 Score: 84.3 bits (207), Expect = 1.0e-13 Identity = 41/45 (91.11%), Postives = 43/45 (95.56%), Query Frame = -2
BLAST of CU117917 vs. NCBI nr
Match: gi|449443412|ref|XP_004139471.1| (PREDICTED: uncharacterized protein LOC101222629 isoform X2 [Cucumis sativus]) HSP 1 Score: 65.1 bits (157), Expect = 6.4e-08 Identity = 27/27 (100.00%), Postives = 27/27 (100.00%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|