CU117785 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AAGAAGCGGGGATAGGGTTCAAGATAAATGGTTTGGAGCCATAATGGATTGTTTGTTTTCAGTGTTTTGTGCTTTCTATATAGTGTGGTTTCTTGTCTTCTCGGTCGAACCCCACACTTGCCCATTGTTGCTGATGCTGCTGGCAGGCAGATTTAGCTTCCAGCTAGGTAGGTTTGTAGCAACTAATGGTGGAGGGAAGCAAGCTGAAGTGAACATTGTTCCACTAGTATAAAGTATGCACCTCAATCTGGAGGTTGGAGGTTAAACCATCTCGCCAAA
BLAST of CU117785 vs. Swiss-Prot
Match: TI202_ARATH (Protein TIC 20-II, chloroplastic OS=Arabidopsis thaliana GN=TIC20-II PE=2 SV=1) HSP 1 Score: 70.5 bits (171), Expect = 1.1e-11 Identity = 30/48 (62.50%), Postives = 37/48 (77.08%), Query Frame = 1
BLAST of CU117785 vs. TrEMBL
Match: A0A0A0LXS7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G654890 PE=4 SV=1) HSP 1 Score: 92.4 bits (228), Expect = 3.1e-16 Identity = 44/50 (88.00%), Postives = 46/50 (92.00%), Query Frame = 1
BLAST of CU117785 vs. TrEMBL
Match: M5W7U9_PRUPE (Uncharacterized protein (Fragment) OS=Prunus persica GN=PRUPE_ppa022924mg PE=4 SV=1) HSP 1 Score: 75.9 bits (185), Expect = 3.0e-11 Identity = 34/50 (68.00%), Postives = 41/50 (82.00%), Query Frame = 1
BLAST of CU117785 vs. TrEMBL
Match: A0A0D2UI35_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_010G239700 PE=4 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 1.1e-10 Identity = 34/48 (70.83%), Postives = 39/48 (81.25%), Query Frame = 1
BLAST of CU117785 vs. TrEMBL
Match: D7LHC8_ARALL (Putative uncharacterized protein OS=Arabidopsis lyrata subsp. lyrata GN=ARALYDRAFT_483969 PE=4 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 1.1e-10 Identity = 31/48 (64.58%), Postives = 40/48 (83.33%), Query Frame = 1
BLAST of CU117785 vs. TrEMBL
Match: G7KRK7_MEDTR (Tic20, putative OS=Medicago truncatula GN=MTR_7g080300 PE=4 SV=2) HSP 1 Score: 73.9 bits (180), Expect = 1.1e-10 Identity = 33/48 (68.75%), Postives = 40/48 (83.33%), Query Frame = 1
BLAST of CU117785 vs. NCBI nr
Match: gi|449442661|ref|XP_004139099.1| (PREDICTED: protein TIC 20-II, chloroplastic [Cucumis sativus]) HSP 1 Score: 95.5 bits (236), Expect = 5.2e-17 Identity = 44/50 (88.00%), Postives = 46/50 (92.00%), Query Frame = 1
BLAST of CU117785 vs. NCBI nr
Match: gi|659085922|ref|XP_008443678.1| (PREDICTED: protein TIC 20-II, chloroplastic [Cucumis melo]) HSP 1 Score: 94.0 bits (232), Expect = 1.5e-16 Identity = 43/48 (89.58%), Postives = 45/48 (93.75%), Query Frame = 1
BLAST of CU117785 vs. NCBI nr
Match: gi|502105641|ref|XP_004492852.1| (PREDICTED: protein TIC 20-II, chloroplastic [Cicer arietinum]) HSP 1 Score: 80.1 bits (196), Expect = 2.2e-12 Identity = 33/44 (75.00%), Postives = 40/44 (90.91%), Query Frame = 1
BLAST of CU117785 vs. NCBI nr
Match: gi|1012119328|ref|XP_015961943.1| (PREDICTED: protein TIC 20-II, chloroplastic [Arachis duranensis]) HSP 1 Score: 79.3 bits (194), Expect = 3.8e-12 Identity = 35/50 (70.00%), Postives = 42/50 (84.00%), Query Frame = 1
BLAST of CU117785 vs. NCBI nr
Match: gi|645223097|ref|XP_008218467.1| (PREDICTED: protein TIC 20-II, chloroplastic [Prunus mume]) HSP 1 Score: 79.0 bits (193), Expect = 5.0e-12 Identity = 34/50 (68.00%), Postives = 41/50 (82.00%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|