CU117607 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGGAGTGTTTTGTTTATCATGCACGAGCAGCGGAAACTAGATTGCCATGCTTGGAGCAAGGAGTAGGAAGAAGTGTTATGTGCGTTGAGCTGGTTGCTAATCGCTTCCTGCGGAAGATGGTACGTGTACTTGTTGCAACAGCAATTAGAGAAGCAGCTGCTGGTGCAGGAGAGGATGCGTTACTAGAGCTGATGGATGCCACATGTCG
BLAST of CU117607 vs. TrEMBL
Match: A0A0A0LV59_CUCSA (tRNA pseudouridine synthase OS=Cucumis sativus GN=Csa_1G025830 PE=3 SV=1) HSP 1 Score: 107.8 bits (268), Expect = 5.4e-21 Identity = 55/70 (78.57%), Postives = 55/70 (78.57%), Query Frame = 1
BLAST of CU117607 vs. TrEMBL
Match: B9SDU2_RICCO (tRNA pseudouridine synthase OS=Ricinus communis GN=RCOM_1712560 PE=3 SV=1) HSP 1 Score: 91.7 bits (226), Expect = 4.0e-16 Identity = 45/70 (64.29%), Postives = 49/70 (70.00%), Query Frame = 1
BLAST of CU117607 vs. TrEMBL
Match: A0A061GS38_THECC (tRNA pseudouridine synthase OS=Theobroma cacao GN=TCM_039779 PE=3 SV=1) HSP 1 Score: 90.9 bits (224), Expect = 6.8e-16 Identity = 45/70 (64.29%), Postives = 49/70 (70.00%), Query Frame = 1
BLAST of CU117607 vs. TrEMBL
Match: A0A061GRT3_THECC (tRNA pseudouridine synthase OS=Theobroma cacao GN=TCM_039779 PE=3 SV=1) HSP 1 Score: 90.9 bits (224), Expect = 6.8e-16 Identity = 45/70 (64.29%), Postives = 49/70 (70.00%), Query Frame = 1
BLAST of CU117607 vs. TrEMBL
Match: A0A0D2TLS5_GOSRA (tRNA pseudouridine synthase OS=Gossypium raimondii GN=B456_012G097600 PE=3 SV=1) HSP 1 Score: 89.7 bits (221), Expect = 1.5e-15 Identity = 45/70 (64.29%), Postives = 49/70 (70.00%), Query Frame = 1
BLAST of CU117607 vs. NCBI nr
Match: gi|449439176|ref|XP_004137363.1| (PREDICTED: uncharacterized protein LOC101205562 [Cucumis sativus]) HSP 1 Score: 107.8 bits (268), Expect = 7.7e-21 Identity = 55/70 (78.57%), Postives = 55/70 (78.57%), Query Frame = 1
BLAST of CU117607 vs. NCBI nr
Match: gi|659107096|ref|XP_008453520.1| (PREDICTED: uncharacterized protein LOC103494203 [Cucumis melo]) HSP 1 Score: 104.4 bits (259), Expect = 8.5e-20 Identity = 54/70 (77.14%), Postives = 54/70 (77.14%), Query Frame = 1
BLAST of CU117607 vs. NCBI nr
Match: gi|255566350|ref|XP_002524161.1| (PREDICTED: tRNA pseudouridine synthase A isoform X1 [Ricinus communis]) HSP 1 Score: 91.7 bits (226), Expect = 5.7e-16 Identity = 45/70 (64.29%), Postives = 49/70 (70.00%), Query Frame = 1
BLAST of CU117607 vs. NCBI nr
Match: gi|1000955470|ref|XP_015577862.1| (PREDICTED: tRNA pseudouridine synthase A isoform X2 [Ricinus communis]) HSP 1 Score: 91.7 bits (226), Expect = 5.7e-16 Identity = 45/70 (64.29%), Postives = 49/70 (70.00%), Query Frame = 1
BLAST of CU117607 vs. NCBI nr
Match: gi|1000955472|ref|XP_015577863.1| (PREDICTED: tRNA pseudouridine synthase A isoform X3 [Ricinus communis]) HSP 1 Score: 91.7 bits (226), Expect = 5.7e-16 Identity = 45/70 (64.29%), Postives = 49/70 (70.00%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|