CU117041 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTGAAAAAGAAGGTTCAAACGACAATATTCATCATTTTATAGAAGAGAAGTTGACAAGTCTAATCTTGAAATATTCTACCTAAGAAAGTGATTGCCTCTTATTTCATCATGGCCTAGTTTCAACCTTACATTTCCCAATAGTATTTTCACAGTTCTTGTTGTTGTCGTCGGCCTCATCCTCACCTTCTCCGGGTCTGCTCATTTGGTACAAGAATATGCAGTTTCAAACGTCCATTTT
BLAST of CU117041 vs. TrEMBL
Match: A0A0A0LVU3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G166760 PE=4 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 8.4e-07 Identity = 26/26 (100.00%), Postives = 26/26 (100.00%), Query Frame = -1
BLAST of CU117041 vs. NCBI nr
Match: gi|449443640|ref|XP_004139585.1| (PREDICTED: protein FAF-like, chloroplastic [Cucumis sativus]) HSP 1 Score: 60.5 bits (145), Expect = 1.6e-06 Identity = 26/26 (100.00%), Postives = 26/26 (100.00%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|